Result : P9WJ18
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Putative antitoxin VapB42 |
| NCBI Accession ID | AE000516.2 |
| Organism | Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh) |
| Left | 3065990 |
| Right | 3066259 |
| Strand | - |
| Nucleotide Sequence | ATGAGCCTCAATATCAAGAGCCAGCGCACCGTGGCGCTGGTGCGGGAACTGGCCGCACGCACCGGCACCAACCAGACGGCTGCTGTCGAGGACGCCGTCGCGCGCCGCCTCTCGGAGTTGGACCGCGAGGACAGGGCACGCGCGGAGGCCCGGCGCGCCGCCGCCGAACAGACCCTGCGCGACCTCGACAAGCTGCTCAGCGACGACGACAAGCGCCTGATTCGGCGACACGAGGTCGACCTCTACGATGACAGCGGTCTGCCCCGGTGA |
| Sequence | MSLNIKSQRTVALVRELAARTGTNQTAAVEDAVARRLSELDREDRARAEARRAAAEQTLRDLDKLLSDDDKRLIRRHEVDLYDDSGLPR |
| Source of smORF | Swiss-Prot |
| Function | Possibly the antitoxin component of a type II toxin-antitoxin (TA) system. Its cognate toxin is VapC42 (Potential). {ECO:0000305}. |
| Pubmed ID | 12218036 |
| Domain | CDD:413087 |
| Functional Category | Antitoxin_type_2 |
| Uniprot ID | P9WJ18 |
| ORF Length (Amino Acid) | 89 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3071267 | 3071536 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 3130497 | 3130766 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 3 | 5813726 | 5813995 | + | NZ_AP022567.1 | Mycolicibacterium mageritense |
| 4 | 2341138 | 2341401 | + | NZ_AP022595.1 | Mycolicibacterium sarraceniae |
| 5 | 2955687 | 2955965 | - | NZ_CP014209.1 | Isoptericola dokdonensis DS-3 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02511.17 | 0.6 | 3 | 3322 | same-strand | Thymidylate synthase complementing protein |
| 2 | PF01850.23 | 1.0 | 5 | -3 | same-strand | PIN domain |
++ More..