Protein Information |
Information Type | Description |
---|---|
Protein name | PE family immunomodulator PE35 |
NCBI Accession ID | AL123456.3 |
Organism | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) |
Left | 4350745 |
Right | 4351044 |
Strand | + |
Nucleotide Sequence | ATGGAAAAAATGTCACATGATCCGATCGCTGCCGACATTGGCACGCAAGTGAGCGACAACGCTCTGCACGGCGTGACGGCCGGCTCGACGGCGCTGACGTCGGTGACCGGGCTGGTTCCCGCGGGGGCCGATGAGGTCTCCGCCCAAGCGGCGACGGCGTTCACATCGGAGGGCATCCAATTGCTGGCTTCCAATGCATCGGCCCAAGACCAGCTCCACCGTGCGGGCGAAGCGGTCCAGGACGTCGCCCGCACCTATTCGCAAATCGACGACGGCGCCGCCGGCGTCTTCGCCGAATAG |
Sequence | MEKMSHDPIAADIGTQVSDNALHGVTAGSTALTSVTGLVPAGADEVSAQAATAFTSEGIQLLASNASAQDQLHRAGEAVQDVARTYSQIDDGAAGVFAE |
Source of smORF | Swiss-Prot |
Function | Plays a major role in RD1-associated pathogenesis, and may contribute to the establishment and maintenance of M.tuberculosis infection. Together with PPE68, stimulates the secretion of IL-10 and MCP-1 from human macrophages, via the interaction with human Toll-like receptor 2 (TLR2). {ECO:0000269|Pubmed:24467650}. |
Pubmed ID | 9634230 16030141 16368961 17328726 17443846 24467650 |
Domain | |
Functional Category | Others |
Uniprot ID | P9WIG7 |
ORF Length (Amino Acid) | 99 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4350745 | 4351044 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
2 | 4196171 | 4196506 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
3 | 4421119 | 4421415 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
4 | 4264904 | 4265239 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
5 | 5548123 | 5548419 | + | NZ_LR130759.1 | Mycobacterium basiliense |
6 | 5376112 | 5376420 | - | NZ_LR130759.1 | Mycobacterium basiliense |
7 | 120047 | 120343 | + | NZ_LR130759.1 | Mycobacterium basiliense |
8 | 4635865 | 4636161 | - | NZ_AP022581.1 | Mycobacterium lacus |
9 | 4795937 | 4796272 | + | NZ_AP022581.1 | Mycobacterium lacus |
10 | 3171696 | 3171992 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
11 | 3014395 | 3014730 | - | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
12 | 248874 | 249209 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
13 | 3373626 | 3373922 | + | NZ_AP022575.1 | Mycobacterium shinjukuense |
14 | 1086646 | 1086942 | - | NZ_AP022572.1 | Mycobacterium shottsii |
15 | 1408211 | 1408507 | + | NZ_CP058277.1 | Mycobacterium marinum |
16 | 1688028 | 1688324 | + | NZ_CP058277.1 | Mycobacterium marinum |
17 | 6007039 | 6007335 | + | NZ_AP018410.1 | Mycobacterium pseudoshottsii JCM 15466 |
18 | 1281084 | 1281380 | - | NZ_CP043474.1 | Mycobacterium grossiae |
19 | 85732 | 86025 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
20 | 1509076 | 1509369 | + | NZ_CP012150.1 | Mycobacterium goodii |
21 | 4221277 | 4221570 | - | NZ_AP022608.1 | Mycolicibacterium gadium |
22 | 3483672 | 3483968 | - | NZ_AP022593.1 | Mycolicibacterium arabiense |
23 | 3984020 | 3984352 | - | NZ_AP022582.1 | Mycobacterium seoulense |
24 | 2283605 | 2283898 | - | NZ_AP022599.1 | Mycolicibacterium pulveris |
25 | 3589341 | 3589634 | - | NZ_AP022565.1 | Mycolicibacterium alvei |
26 | 69312 | 69608 | + | NZ_LT906483.1 | Mycolicibacterium thermoresistibile |
27 | 3825943 | 3826275 | - | NZ_AP022619.1 | Mycobacterium paraseoulense |
28 | 55194 | 55487 | + | NZ_CP011269.1 | Mycolicibacterium fortuitum |
29 | 1357751 | 1358044 | + | NZ_AP022579.1 | Mycolicibacterium boenickei |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00004.31 | 0.86 | 18 | 5636.5 | same-strand | ATPase family associated with various cellular activities (AAA) |
2 | PF17866.3 | 0.81 | 17 | 5637 | same-strand | AAA lid domain |
3 | PF05108.15 | 0.86 | 18 | 4159.0 | same-strand | Type VII secretion system ESX-1, transport TM domain B |
4 | PF01580.20 | 0.86 | 18 | 1045.5 | same-strand | FtsK/SpoIIIE family |
5 | PF00823.21 | 0.9 | 19 | 46 | same-strand | PPE family |
6 | PF06013.14 | 0.9 | 19 | 1568 | same-strand | Proteins of 100 residues with WXG |
7 | PF10824.10 | 0.81 | 17 | 1275 | same-strand | Excreted virulence factor EspC, type VII ESX diderm |
8 | PF01656.25 | 0.71 | 15 | 2216 | same-strand | CobQ/CobB/MinD/ParA nucleotide binding domain |