Protein Information |
Information Type | Description |
---|---|
Protein name | Antitoxin VapB47 |
NCBI Accession ID | AL123456.3 |
Organism | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) |
Left | 3826252 |
Right | 3826551 |
Strand | + |
Nucleotide Sequence | ATGCGTGCTACCGTTGGGCTTGTGGAGGCAATCGGAATCCGAGAACTAAGACAGCACGCATCGCGATACCTCGCCCGGGTTGAAGCCGGCGAGGAACTTGGCGTCACCAACAAAGGAAGACTTGTGGCCCGACTCATCCCGGTGCAGGCCGCGGAGCGTTCTCGCGAAGCCCTGATTGAATCAGGTGTCCTGATTCCGGCTCGTCGTCCACAAAACCTTCTCGACGTCACCGCCGAACCGGCGCGCGGCCGCAAGCGCACCCTGTCCGATGTTCTCAACGAAATGCGCGACGAGCAGTGA |
Sequence | MRATVGLVEAIGIRELRQHASRYLARVEAGEELGVTNKGRLVARLIPVQAAERSREALIESGVLIPARRPQNLLDVTAEPARGRKRTLSDVLNEMRDEQ |
Source of smORF | Swiss-Prot |
Function | Antitoxin component of a type II toxin-antitoxin (TA) system. Upon expression in M.smegmatis neutralizes the effect of cognate toxin VapC47. {ECO:0000269|Pubmed:20011113}. |
Pubmed ID | 9634230 20011113 21969609 |
Domain | CDD:415595 |
Functional Category | Antitoxin_type_2 |
Uniprot ID | P9WF23 |
ORF Length (Amino Acid) | 99 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3826252 | 3826551 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
2 | 3893509 | 3893808 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
3 | 5803459 | 5803758 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
4 | 1513487 | 1513765 | + | NZ_AP022581.1 | Mycobacterium lacus |
5 | 2558461 | 2558739 | - | NZ_LR134355.1 | Mycolicibacterium chitae |
6 | 5235516 | 5235797 | + | NZ_AP022616.1 | Mycolicibacterium phocaicum |
7 | 1819600 | 1819869 | + | NC_008726.1 | Mycolicibacterium vanbaalenii PYR-1 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01850.23 | 0.86 | 6 | 1.5 | same-strand | PIN domain |