Result : P9WF23
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Antitoxin VapB47 |
| NCBI Accession ID | AL123456.3 |
| Organism | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) |
| Left | 3826252 |
| Right | 3826551 |
| Strand | + |
| Nucleotide Sequence | ATGCGTGCTACCGTTGGGCTTGTGGAGGCAATCGGAATCCGAGAACTAAGACAGCACGCATCGCGATACCTCGCCCGGGTTGAAGCCGGCGAGGAACTTGGCGTCACCAACAAAGGAAGACTTGTGGCCCGACTCATCCCGGTGCAGGCCGCGGAGCGTTCTCGCGAAGCCCTGATTGAATCAGGTGTCCTGATTCCGGCTCGTCGTCCACAAAACCTTCTCGACGTCACCGCCGAACCGGCGCGCGGCCGCAAGCGCACCCTGTCCGATGTTCTCAACGAAATGCGCGACGAGCAGTGA |
| Sequence | MRATVGLVEAIGIRELRQHASRYLARVEAGEELGVTNKGRLVARLIPVQAAERSREALIESGVLIPARRPQNLLDVTAEPARGRKRTLSDVLNEMRDEQ |
| Source of smORF | Swiss-Prot |
| Function | Antitoxin component of a type II toxin-antitoxin (TA) system. Upon expression in M.smegmatis neutralizes the effect of cognate toxin VapC47. {ECO:0000269|Pubmed:20011113}. |
| Pubmed ID | 9634230 20011113 21969609 |
| Domain | CDD:415595 |
| Functional Category | Antitoxin_type_2 |
| Uniprot ID | P9WF23 |
| ORF Length (Amino Acid) | 99 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3826252 | 3826551 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 3893509 | 3893808 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 3 | 5803459 | 5803758 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 4 | 1513487 | 1513765 | + | NZ_AP022581.1 | Mycobacterium lacus |
| 5 | 2558461 | 2558739 | - | NZ_LR134355.1 | Mycolicibacterium chitae |
| 6 | 5235516 | 5235797 | + | NZ_AP022616.1 | Mycolicibacterium phocaicum |
| 7 | 1819600 | 1819869 | + | NC_008726.1 | Mycolicibacterium vanbaalenii PYR-1 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01850.23 | 0.86 | 6 | 1.5 | same-strand | PIN domain |
++ More..