Result : P9WF16
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Antitoxin VapB35 |
| NCBI Accession ID | AE000516.2 |
| Organism | Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh) |
| Left | 2202609 |
| Right | 2202881 |
| Strand | - |
| Nucleotide Sequence | GTGAATGAGGTGTCCATACGAACGCTCAACCAGGAGACGTCCAAGGTCCTGGCCCGCGTCAAGCGCGGTGAAGAGATCAACCTGACTGAGCGCGGCAAGGTTATCGCCCGAATAATCCCGGCTTCTGCCGGCCCTCTCGACTCACTGATCAGCACCGGCAGTGTGCAACCGGCGAGAGTGCATGGCCCGGCGCCTCGGCCCACAATTCCGATGCGCGGCGGTCTCGACTCGGGAACGCTGTTGGAGCGCATGCGCGCCGAGGAGCGGTACTAG |
| Sequence | MNEVSIRTLNQETSKVLARVKRGEEINLTERGKVIARIIPASAGPLDSLISTGSVQPARVHGPAPRPTIPMRGGLDSGTLLERMRAEERY |
| Source of smORF | Swiss-Prot |
| Function | Antitoxin component of a type II toxin-antitoxin (TA) system. Neutralizes the effect of cognate toxin VapC35 (By similarity). {ECO:0000250}. |
| Pubmed ID | 12218036 |
| Domain | CDD:415595 |
| Functional Category | Antitoxin_type_2 |
| Uniprot ID | P9WF16 |
| ORF Length (Amino Acid) | 90 |
++ More..
| Conservation Analysis |
No. of Species: 14
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2205277 | 2205549 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 2249284 | 2249556 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 3 | 1388803 | 1389075 | + | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 4 | 5293933 | 5294205 | - | NZ_AP022614.1 | Mycobacterium parmense |
| 5 | 1177456 | 1177728 | + | NZ_AP022603.1 | Mycolicibacterium fallax |
| 6 | 5453996 | 5454268 | + | NZ_CP061007.1 | Saccharopolyspora spinosa |
| 7 | 9982710 | 9982982 | - | NC_022116.1 | Amycolatopsis mediterranei RB |
| 8 | 1290315 | 1290587 | + | NZ_CP022752.1 | Actinopolyspora erythraea |
| 9 | 4563582 | 4563854 | - | NZ_CP031142.1 | Saccharopolyspora pogona |
| 10 | 653804 | 654031 | + | NZ_AP022606.1 | Mycobacterium branderi |
| 11 | 1419527 | 1419799 | - | NZ_CP045929.1 | Saccharopolyspora coralli |
| 12 | 5348156 | 5348428 | + | NZ_CP043661.1 | Kribbella qitaiheensis |
| 13 | 1618403 | 1618675 | + | NZ_CP016076.1 | Actinoalloteichus fjordicus |
| 14 | 7740804 | 7741076 | - | NZ_CP007155.1 | Kutzneria albida DSM 43870 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01850.23 | 1.0 | 14 | 0 | same-strand | PIN domain |
++ More..