Protein Information |
Information Type | Description |
---|---|
Protein name | Uncharacterized protein YdcS |
NCBI Accession ID | AB001488.1 |
Organism | Bacillus subtilis (strain 168) |
Left | 69332 |
Right | 69601 |
Strand | + |
Nucleotide Sequence | ATGCATAATGTCAATCTGTTGAATCAGGCTGGACTGGAAAATGCTTTGGAATCAGTTGGCTGTTTAGATATTGTAGAAGATTTAATAGAAAAGATGCAGGAATATGTTTTGTATCATACCGAAACTGCCGAAAGATTTGCGATTGATATCTTTACAGTAGTAAACAACTACACTAAAAAGGTTCATGCGATATTTAATGTTCTTGAAAATGAAGACGGTGAGACAAATGTTAAAAATGTAGAATTTGAAGTAATGCATTTTACGGAGTAA |
Sequence | MHNVNLLNQAGLENALESVGCLDIVEDLIEKMQEYVLYHTETAERFAIDIFTVVNNYTKKVHAIFNVLENEDGETNVKNVEFEVMHFTE |
Source of smORF | Swiss-Prot |
Function | |
Pubmed ID | 9384377 |
Domain | |
Functional Category | Others |
Uniprot ID | P96636 |
ORF Length (Amino Acid) | 89 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 536096 | 536365 | + | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
2 | 536449 | 536670 | + | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
3 | 473636 | 473902 | - | NZ_CP033052.1 | Bacillus vallismortis |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF06125.13 | 1.0 | 2 | 3019 | same-strand | Bacterial protein of unknown function (DUF961) |
2 | PF02486.21 | 1.0 | 2 | 491 | same-strand | Replication initiation factor |
3 | PF18106.3 | 1.0 | 2 | 491 | same-strand | Rolling Circle replication initiation protein N-terminal domain |
4 | PF12642.9 | 1.0 | 2 | 315 | same-strand | Conjugative transposon protein TcpC |
5 | PF12648.9 | 1.0 | 2 | 1653 | same-strand | TcpE family |
6 | PF12846.9 | 1.0 | 2 | 2253.5 | same-strand | AAA-like domain |