Result : P96636

Protein Information

• Protein name: Uncharacterized protein YdcS
• NCBI Accession ID: AB001488.1
• Organism: Bacillus subtilis (strain 168)
• Left: 69332
• Right: 69601
• Strand: +
• Nucleotide Sequence: ATGCATAATGTCAATCTGTTGAATCAGGCTGGACTGGAAAATGCTTTGGAATCAGTTGGCTGTTTAGATATTGTAGAAGATTTAATAGAAAAGATGCAGGAATATGTTTTGTATCATACCGAAACTGCCGAAAGATTTGCGATTGATATCTTTACAGTAGTAAACAACTACACTAAAAAGGTTCATGCGATATTTAATGTTCTTGAAAATGAAGACGGTGAGACAAATGTTAAAAATGTAGAATTTGAAGTAATGCATTTTACGGAGTAA
• Sequence: MHNVNLLNQAGLENALESVGCLDIVEDLIEKMQEYVLYHTETAERFAIDIFTVVNNYTKKVHAIFNVLENEDGETNVKNVEFEVMHFTE
• Source of smORF: Swiss-Prot
• Pubmed ID: 9384377
• Functional Category: Others
• Uniprot ID: P96636
• ORF Length (Amino Acid): 89

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	536096	536365	+	NC_000964.3	Bacillus subtilis subsp. subtilis str. 168
2	536449	536670	+	NC_000964.3	Bacillus subtilis subsp. subtilis str. 168
3	473636	473902	-	NZ_CP033052.1	Bacillus vallismortis

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000964.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF06125.13	1.0	2	3019	same-strand	Bacterial protein of unknown function (DUF961)
2	PF02486.21	1.0	2	491	same-strand	Replication initiation factor
3	PF18106.3	1.0	2	491	same-strand	Rolling Circle replication initiation protein N-terminal domain
4	PF12642.9	1.0	2	315	same-strand	Conjugative transposon protein TcpC
5	PF12648.9	1.0	2	1653	same-strand	TcpE family
6	PF12846.9	1.0	2	2253.5	same-strand	AAA-like domain