Result : P94416
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Phosphatase RapC inhibitor (Phosphatase regulator C) |
| NCBI Accession ID | D50453.1 |
| Organism | Bacillus subtilis (strain 168) |
| Left | 109196 |
| Right | 109318 |
| Strand | + |
| Nucleotide Sequence | ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGCGGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA |
| Sequence | MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT |
| Source of smORF | Swiss-Prot |
| Function | Inhibitor of the activity of phosphatase RapC. |
| Pubmed ID | 8969502 9384377 |
| Domain | CDD:288035 |
| Functional Category | Others |
| Uniprot ID | P94416 |
| ORF Length (Amino Acid) | 40 |
++ More..
| Conservation Analysis |
No. of Species: 9
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 429963 | 430085 | + | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 2 | 427407 | 427529 | + | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 3 | 382865 | 382987 | + | NZ_CP013984.1 | Bacillus inaquosorum |
| 4 | 1581203 | 1581325 | - | NZ_CP029364.1 | Bacillus halotolerans |
| 5 | 428383 | 428505 | + | NZ_CP051464.1 | Bacillus mojavensis |
| 6 | 406216 | 406338 | + | NZ_CP048852.1 | Bacillus tequilensis |
| 7 | 585986 | 586108 | + | NZ_CP033052.1 | Bacillus vallismortis |
| 8 | 420935 | 421054 | + | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 9 | 3533003 | 3533122 | - | NZ_CP011937.1 | Bacillus velezensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP034943.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00005.29 | 1.0 | 9 | 5046 | opposite-strand | ABC transporter |
| 2 | PF02687.23 | 0.89 | 8 | 3600.0 | opposite-strand | FtsX-like permease family |
| 3 | PF00486.30 | 0.89 | 8 | 2704.0 | same-strand | Transcriptional regulatory protein, C terminal |
| 4 | PF00072.26 | 0.89 | 8 | 2704.0 | same-strand | Response regulator receiver domain |
| 5 | PF02518.28 | 0.89 | 8 | 1294.5 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 6 | PF00512.27 | 0.89 | 8 | 1294.5 | same-strand | His Kinase A (phospho-acceptor) domain |
| 7 | PF00672.27 | 0.89 | 8 | 1294.5 | same-strand | HAMP domain |
| 8 | PF18801.3 | 1.0 | 9 | -16 | same-strand | response regulator aspartate phosphatase H, N terminal |
| 9 | PF13424.8 | 1.0 | 9 | -16 | same-strand | Tetratricopeptide repeat |
| 10 | PF07719.19 | 0.67 | 6 | -16.0 | same-strand | Tetratricopeptide repeat |
| 11 | PF13181.8 | 0.78 | 7 | -16 | same-strand | Tetratricopeptide repeat |
| 12 | PF13174.8 | 0.89 | 8 | -16.0 | same-strand | Tetratricopeptide repeat |
| 13 | PF09680.12 | 0.78 | 7 | 105 | opposite-strand | Family of unknown function |
| 14 | PF00696.30 | 1.0 | 9 | 373 | opposite-strand | Amino acid kinase family |
| 15 | PF13840.8 | 1.0 | 9 | 373 | opposite-strand | ACT domain |
| 16 | PF01032.20 | 1.0 | 9 | 2701.5 | same-strand | FecCD transport family |
| 17 | PF13432.8 | 0.78 | 7 | -16 | same-strand | Tetratricopeptide repeat |
++ More..