| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Prophage lipoprotein Bor homolog (Lipoprotein Bor homolog from lambdoid prophage DLP12) |
| NCBI Accession ID | U82598.1 |
| Organism | Escherichia coli (strain K12) |
| Left | 19231 |
| Right | 19524 |
| Strand | - |
| Nucleotide Sequence | ATGAAAAAAATGCTACTCGCTACTGCGCTGGCCCTGCTTATTACAGGATGTGCTCAACAGACATTTACTGTTCAAAACAAACAGACAGCAGTAGCACCAAAGGAAACCATCACCCATCATTTCTTCGTTTCTGGAATTGGGCAGAAGAAAACTGTCGATGCAGCTAAAATTTGTGGCGGCGCAGAAAATGTTGTTAAAACAGAAACCCAGCAAACATTCGTAAATGGATTGCTCGGTTTTATTACTTTAGGCATTTATACTCCGCTGGAAGCGCGTGTGTATTGCTCAAAATAA |
| Sequence | MKKMLLATALALLITGCAQQTFTVQNKQTAVAPKETITHHFFVSGIGQKKTVDAAKICGGAENVVKTETQQTFVNGLLGFITLGIYTPLEARVYCSK |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of pfam06291. Profile Description: Bor protein. This family consists of several Bacteriophage lambda Bor and Escherichia coli Iss proteins. Expression of bor significantly increases the survival of the Escherichia coli host cell in animal serum. This property is a well known bacterial virulence determinant indeed, bor and its adjacent sequences are highly homologous to the iss serum resistance locus of the plasmid ColV2-K94, which confers virulence in animals. It has been suggested that lysogeny may generally have a role in bacterial survival in animal hosts, and perhaps in pathogenesis. |
| Pubmed ID | 9278503 16738553 |
| Domain | CDD:399354 |
| Functional Category | Others |
| Uniprot ID | P77330 |
| ORF Length (Amino Acid) | 97 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 578600 | 578893 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 1275032 | 1275325 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 1627986 | 1628279 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 37199 | 37492 | - | NZ_CP068597.1 | Paenibacillus sonchi |
| 5 | 1221594 | 1221887 | - | NZ_AP014857.1 | Escherichia albertii |
| 6 | 4185307 | 4185597 | - | NZ_CP047495.1 | Pectobacterium brasiliense |
| 7 | 1417069 | 1417359 | - | NZ_CP017482.1 | Pectobacterium polaris |
| 8 | 2759660 | 2759950 | - | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 9 | 1364508 | 1364798 | + | NZ_CP015749.1 | Pectobacterium parmentieri |
| 10 | 4395568 | 4395858 | - | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 11 | 3517303 | 3517593 | - | NZ_CP065640.1 | Serratia rubidaea |
| 12 | 2229060 | 2229350 | - | NZ_AP023184.1 | Buttiauxella agrestis |
| 13 | 1461899 | 1462189 | + | NZ_AP023184.1 | Buttiauxella agrestis |
| 14 | 3362052 | 3362342 | + | NZ_CP060111.1 | Klebsiella michiganensis |
| 15 | 788580 | 788870 | + | NC_010694.1 | Erwinia tasmaniensis Et1/99 |
| 16 | 2031751 | 2032041 | - | NZ_CP065745.1 | Aeromonas allosaccharophila |
| 17 | 2510343 | 2510633 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 18 | 52087 | 52383 | - | NC_011744.2 | Vibrio atlanticus |
| 19 | 755606 | 755896 | + | NZ_LN907827.1 | Erwinia gerundensis |
| 20 | 65977 | 66267 | + | NZ_CP034149.1 | Pantoea agglomerans |
| 21 | 885478 | 885768 | - | NZ_CP009354.1 | Vibrio tubiashii ATCC 19109 |
| 22 | 3487881 | 3488177 | - | NZ_CP014864.1 | Microbulbifer thermotolerans |
| 23 | 411804 | 412055 | - | NZ_CP019239.1 | Rhodoferax saidenbachensis |
| 24 | 1185541 | 1185819 | + | NC_021883.1 | Mannheimia haemolytica USMARC_2286 |