Protein Information |
Information Type | Description |
---|---|
Protein name | Putative uncharacterized protein YkiA |
NCBI Accession ID | AP009048.1 |
Organism | Escherichia coli (strain K12) |
Left | 407893 |
Right | 408174 |
Strand | + |
Nucleotide Sequence | TTGCTGCAAAGTCGCAATGATCATTTACGCCAAACGGCATTGCGCAACGCACATACCCCGGCGTTGTTGTTAACGACATTGACTGAGCCTCAGGATCGGTCGCTGGCTATTAATAATCCACAGCTGGCTGCCGATGTGAAAACGGCGTGGTTAAAAGAGGATCCATCATTACTCTTATTTGTCGAACAACCCGATCTTTCGCTGTTACGTGATTTAGTGAAAACCGGGGCAACGCGGAAAATTCGCAGTGAAGCGCGTCACCGGCTTGAGGAAAAACAATGA |
Sequence | MLQSRNDHLRQTALRNAHTPALLLTTLTEPQDRSLAINNPQLAADVKTAWLKEDPSLLLFVEQPDLSLLRDLVKTGATRKIRSEARHRLEEKQ |
Source of smORF | Swiss-Prot |
Function | The ORF matches to the profile of pfam10971. Profile Description: Protein of unknown function (DUF2773). This family of proteins with unknown function appears to be restricted to Enterobacteriaceae. |
Pubmed ID | 9278503 16738553 |
Domain | CDD:287885 |
Functional Category | Others |
Uniprot ID | P75704 |
ORF Length (Amino Acid) | 93 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 408669 | 408950 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 337913 | 338194 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
3 | 470383 | 470664 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01202.24 | 1.0 | 2 | 1741 | same-strand | Shikimate kinase |
2 | PF13238.8 | 1.0 | 2 | 1741 | same-strand | AAA domain |
3 | PF16362.7 | 1.0 | 2 | 1500 | same-strand | YaiA protein |
4 | PF07302.13 | 1.0 | 2 | 565 | same-strand | AroM protein |
5 | PF06865.13 | 1.0 | 2 | 209 | same-strand | Pyrimidine/purine nucleoside phosphorylase |
6 | PF04381.14 | 1.0 | 2 | 530 | opposite-strand | Putative exonuclease, RdgC |
7 | PF00480.22 | 1.0 | 2 | 1566 | same-strand | ROK family |
8 | PF07690.18 | 1.0 | 2 | 2617 | opposite-strand | Major Facilitator Superfamily |
9 | PF13476.8 | 1.0 | 2 | 3924 | opposite-strand | AAA domain |
10 | PF13558.8 | 1.0 | 2 | 3924 | opposite-strand | Putative exonuclease SbcCD, C subunit |
11 | PF02639.16 | 1.0 | 2 | 3414.5 | same-strand | Uncharacterized BCR, YaiI/YqxD family COG1671 |