| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein HI_1050 |
| NCBI Accession ID | L42023.1 |
| Organism | Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) |
| Left | 1115250 |
| Right | 1115528 |
| Strand | + |
| Nucleotide Sequence | ATGAAGAAATTATGTACCGCACTTTTGCTTTCGCTGTTTGCAATCTCTTTCGCTCATGCGAATGAAACCAAACAAATTGTGCTAAAAGTAAAGGAAATGAATTGTCAGCTTTGTGCTTACTTAGTCAATAAAGAACTGCGTAATATCAATGGCGTTATTTCAACAAAAGCATCTATTAAAGATGGTTTAGTGACGGTTGTGGAAGATCCAAATGTCACAAACCAACAATTATTCGATGCAATTCACAAGCTGAAATATACTGCTGAAGTCGTGAATTAA |
| Sequence | MKKLCTALLLSLFAISFAHANETKQIVLKVKEMNCQLCAYLVNKELRNINGVISTKASIKDGLVTVVEDPNVTNQQLFDAIHKLKYTAEVVN |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl00207. Profile Description: N/A. This model describes an apparently copper-specific subfamily of the metal-binding domain HMA (pfam00403). Closely related sequences outside this model include mercury resistance proteins and repeated domains of eukaryotic eukaryotic copper transport proteins. Members of this family are strictly prokaryotic. The model identifies both small proteins consisting of just this domain and N-terminal regions of cation (probably copper) transporting ATPases. [Transport and binding proteins, Cations and iron carrying compounds] |
| Pubmed ID | 7542800 |
| Domain | CDD:412222 |
| Functional Category | Metal-binding |
| Uniprot ID | P71365 |
| ORF Length (Amino Acid) | 92 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1104576 | 1104854 | + | NZ_LS483429.1 | Haemophilus aegyptius |
| 2 | 1810804 | 1811082 | - | NZ_CP009610.1 | Haemophilus influenzae |
| 3 | 233472 | 233750 | + | NZ_LS483458.1 | Haemophilus haemolyticus |
| 4 | 962959 | 963252 | - | NZ_LR134327.1 | Aggregatibacter aphrophilus ATCC 33389 |
| 5 | 2241627 | 2241932 | - | NZ_LT906448.1 | Pasteurella dagmatis |
| 6 | 550855 | 551157 | + | NZ_CP028926.1 | Pasteurella multocida |
| 7 | 237045 | 237275 | + | NZ_LR134167.1 | Avibacterium volantium |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02411.17 | 0.86 | 6 | 11.0 | same-strand | MerT mercuric transport protein |
| 2 | PF01841.21 | 0.86 | 6 | 343.0 | same-strand | Transglutaminase-like superfamily |