Result : P68810
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C (Asp/Glu-ADT subunit C) (EC 6.3.5.-) |
| NCBI Accession ID | BA000033.2 |
| Organism | Staphylococcus aureus (strain MW2) |
| Left | 2005504 |
| Right | 2005806 |
| Strand | - |
| Nucleotide Sequence | ATGACAAAAGTAACACGTGAAGAAGTTGAGCATATCGCGAATCTTGCAAGACTTCAAATTTCTCCTGAAGAAACGGAAGAAATGGCCAACACATTAGAAAGCATTTTAGATTTTGCAAAACAAAATGATAGCGCTGATACAGAAGGCGTTGAACCTACATATCACGTTTTAGATTTACAAAACGTTTTACGTGAAGATAAAGCAATTAAAGGTATTCCGCAAGAATTAGCTTTGAAAAATGCCAAAGAAACAGAAGATGGACAATTTAAAGTGCCTACAATCATGAATGAGGAGGACGCGTAA |
| Sequence | MTKVTREEVEHIANLARLQISPEETEEMANTLESILDFAKQNDSADTEGVEPTYHVLDLQNVLREDKAIKGIPQELALKNAKETEDGQFKVPTIMNEEDA |
| Source of smORF | Swiss-Prot |
| Function | Allows the formation of correctly charged Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms which lack either or both of asparaginyl-tRNA or glutaminyl-tRNA synthetases. The reaction takes place in the presence of glutamine and ATP through an activated phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA(Gln) (By similarity). {ECO:0000250}. |
| Pubmed ID | 12044378 |
| Domain | CDD:412411 |
| Functional Category | Others |
| Uniprot ID | P68810 |
| ORF Length (Amino Acid) | 100 |
++ More..
| Conservation Analysis |
No. of Species: 76
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1992412 | 1992714 | - | NZ_LR134304.1 | Staphylococcus schweitzeri |
| 2 | 1991204 | 1991506 | - | NC_007795.1 | Staphylococcus aureus subsp. aureus NCTC 8325 |
| 3 | 948237 | 948539 | + | NZ_LR134242.1 | Staphylococcus warneri |
| 4 | 482054 | 482356 | - | NC_022737.1 | Staphylococcus pasteuri SP1 |
| 5 | 1713722 | 1714024 | + | NZ_CP033732.1 | Staphylococcus hominis |
| 6 | 980669 | 980971 | + | NZ_CP035288.1 | Staphylococcus epidermidis |
| 7 | 1039300 | 1039602 | + | NZ_AP018587.1 | Staphylococcus caprae |
| 8 | 1907928 | 1908230 | - | NZ_LT906460.1 | Staphylococcus simiae |
| 9 | 1207891 | 1208193 | - | NZ_CP007601.1 | Staphylococcus capitis subsp. capitis |
| 10 | 2498059 | 2498361 | + | NZ_CP014022.1 | Staphylococcus lugdunensis |
| 11 | 2341670 | 2341972 | - | NZ_CP066042.1 | Staphylococcus saccharolyticus |
| 12 | 1556182 | 1556484 | - | NZ_CP013911.1 | Staphylococcus haemolyticus |
| 13 | 1017454 | 1017756 | + | NZ_CP008724.1 | Staphylococcus xylosus |
| 14 | 952761 | 953063 | + | NZ_LR134089.1 | Staphylococcus saprophyticus |
| 15 | 165861 | 166163 | + | NZ_CP018199.1 | Staphylococcus succinus |
| 16 | 1948798 | 1949100 | - | NZ_CP033460.1 | Staphylococcus debuckii |
| 17 | 1145538 | 1145840 | + | NZ_CP018776.1 | Staphylococcus condimenti |
| 18 | 1760250 | 1760552 | - | NZ_CP013114.1 | Staphylococcus equorum |
| 19 | 978345 | 978647 | + | NZ_CP064056.1 | Staphylococcus lloydii |
| 20 | 823078 | 823380 | - | NZ_CP022096.2 | Staphylococcus pettenkoferi |
| 21 | 822428 | 822730 | + | NZ_CP065712.1 | Staphylococcus auricularis |
| 22 | 787800 | 788099 | + | NZ_LT906462.1 | Mammaliicoccus stepanovicii |
| 23 | 1445684 | 1445983 | - | NZ_CP068061.1 | Mammaliicoccus vitulinus |
| 24 | 703293 | 703592 | + | NZ_CP022046.2 | Mammaliicoccus sciuri |
| 25 | 1723647 | 1723949 | - | NC_014925.1 | Staphylococcus pseudintermedius HKU10-03 |
| 26 | 920055 | 920357 | + | NZ_CP008747.1 | Staphylococcus hyicus |
| 27 | 1554419 | 1554721 | - | NZ_CP045927.1 | Staphylococcus agnetis |
| 28 | 1500484 | 1500786 | - | NZ_LT906464.1 | Staphylococcus muscae |
| 29 | 2396468 | 2396770 | - | NZ_CP027770.1 | Staphylococcus felis |
| 30 | 385247 | 385549 | - | NZ_CP020773.1 | Staphylococcus lutrae |
| 31 | 1883388 | 1883687 | - | NZ_CP047361.1 | Macrococcus canis |
| 32 | 1359780 | 1360079 | - | NZ_CP065729.1 | Macrococcus caseolyticus |
| 33 | 1942125 | 1942424 | - | NZ_CP054482.1 | Macrococcus bohemicus |
| 34 | 1034043 | 1034333 | + | NZ_CP009416.1 | Jeotgalibacillus malaysiensis |
| 35 | 695761 | 696051 | + | NZ_CP053989.1 | Niallia circulans |
| 36 | 1275559 | 1275849 | - | NZ_CP041305.1 | Cytobacillus ciccensis |
| 37 | 182843 | 183133 | + | NZ_CP017703.1 | Aeribacillus pallidus |
| 38 | 1400651 | 1400941 | - | NZ_CP022983.1 | Cytobacillus kochii |
| 39 | 705836 | 706123 | + | NZ_CP010820.1 | Lysinibacillus fusiformis |
| 40 | 826718 | 827014 | + | NZ_CP024848.1 | Oceanobacillus zhaokaii |
| 41 | 310543 | 310833 | + | NC_022524.1 | Bacillus infantis NRRL B-14911 |
| 42 | 3548170 | 3548460 | - | NZ_CP020772.1 | Halobacillus mangrovi |
| 43 | 734160 | 734450 | + | NZ_CP023704.1 | Caldibacillus thermoamylovorans |
| 44 | 404943 | 405233 | + | NC_013791.2 | Alkalihalobacillus pseudofirmus OF4 |
| 45 | 549853 | 550143 | + | NZ_CP017962.1 | Virgibacillus halodenitrificans |
| 46 | 4095473 | 4095760 | - | NZ_CP006837.1 | Lysinibacillus varians |
| 47 | 649993 | 650280 | + | NZ_CP019980.1 | Lysinibacillus sphaericus |
| 48 | 3480741 | 3481031 | + | NZ_CP064060.1 | Anoxybacillus caldiproteolyticus |
| 49 | 1358784 | 1359074 | - | NZ_CP046314.1 | Gemella morbillorum |
| 50 | 1992960 | 1993250 | + | NZ_CP063356.1 | Anaerobacillus isosaccharinicus |
| 51 | 5493326 | 5493616 | - | NZ_LR134338.1 | Brevibacillus brevis |
| 52 | 55131 | 55421 | + | NZ_CP018866.1 | Sutcliffiella cohnii |
| 53 | 718070 | 718360 | + | NC_002570.2 | Alkalihalobacillus halodurans C-125 |
| 54 | 2134964 | 2135254 | - | NZ_CP011361.2 | Salimicrobium jeotgali |
| 55 | 569093 | 569383 | + | NZ_CP008876.1 | Terribacillus goriensis |
| 56 | 610161 | 610451 | + | NZ_CP029797.1 | Paraliobacillus zengyii |
| 57 | 1123893 | 1124183 | - | NZ_LR134484.1 | Gemella haemolysans |
| 58 | 979041 | 979331 | + | NZ_CP016539.2 | Planococcus plakortidis |
| 59 | 693384 | 693674 | + | NZ_CP013659.2 | Planococcus rifietoensis |
| 60 | 2883691 | 2883981 | - | NZ_CP036259.1 | Sporomusa termitida |
| 61 | 966160 | 966450 | + | NZ_CP059540.1 | Planococcus maritimus |
| 62 | 3435622 | 3435912 | - | NZ_CP031223.1 | Psychrobacillus glaciei |
| 63 | 1675772 | 1676047 | - | NZ_CP041217.1 | Saccharibacillus brassicae |
| 64 | 956611 | 956901 | + | NZ_CP016538.2 | Planococcus maritimus |
| 65 | 389836 | 390126 | + | NZ_CP019699.1 | Novibacillus thermophilus |
| 66 | 5188740 | 5188988 | - | NZ_AP019400.1 | Cohnella abietis |
| 67 | 1015112 | 1015402 | + | NZ_CP016534.2 | Planococcus antarcticus DSM 14505 |
| 68 | 808264 | 808554 | - | NZ_CP013661.2 | Planococcus kocurii |
| 69 | 961542 | 961832 | + | NZ_CP019401.1 | Planococcus faecalis |
| 70 | 889589 | 889879 | + | NZ_CP016543.2 | Planococcus donghaensis |
| 71 | 901589 | 901879 | + | NZ_CP016540.2 | Planococcus versutus |
| 72 | 204376 | 204624 | + | NZ_CP033433.1 | Cohnella candidum |
| 73 | 921295 | 921585 | + | NZ_CP016537.2 | Planococcus halocryophilus |
| 74 | 137533 | 137829 | + | NC_015672.1 | Flexistipes sinusarabici DSM 4947 |
| 75 | 1059483 | 1059770 | + | NC_017672.3 | Paenibacillus mucilaginosus K02 |
| 76 | 1017989 | 1018291 | + | NC_011297.1 | Dictyoglomus thermophilum H-6-12 |
| 77 | 263597 | 263860 | + | NC_015416.1 | Methanothrix soehngenii GP6 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR134304.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00781.26 | 0.7 | 53 | 3254 | same-strand | Diacylglycerol kinase catalytic domain |
| 2 | PF19279.1 | 0.7 | 53 | 3254 | same-strand | YegS C-terminal NAD kinase beta sandwich-like domain |
| 3 | PF02934.17 | 1.0 | 76 | 1480 | same-strand | GatB/GatE catalytic domain |
| 4 | PF02637.20 | 1.0 | 76 | 1480 | same-strand | GatB domain |
| 5 | PF01425.23 | 1.0 | 76 | 13 | same-strand | Amidase |
| 6 | PF07537.13 | 0.75 | 57 | 2012.5 | same-strand | CamS sex pheromone cAM373 precursor |
| 7 | PF01653.20 | 0.7 | 53 | 3219.0 | same-strand | NAD-dependent DNA ligase adenylation domain |
| 8 | PF03120.18 | 0.71 | 54 | 3218 | same-strand | NAD-dependent DNA ligase OB-fold domain |
| 9 | PF12826.9 | 0.71 | 54 | 3218 | same-strand | Helix-hairpin-helix motif |
| 10 | PF00533.28 | 0.71 | 54 | 3218 | same-strand | BRCA1 C Terminus (BRCT) domain |
| 11 | PF03119.18 | 0.71 | 54 | 3218 | same-strand | NAD-dependent DNA ligase C4 zinc finger domain |
| 12 | PF14520.8 | 0.7 | 53 | 3216.0 | same-strand | Helix-hairpin-helix domain |
| 13 | PF00580.23 | 0.67 | 51 | 5221.0 | same-strand | UvrD/REP helicase N-terminal domain |
| 14 | PF13361.8 | 0.67 | 51 | 5222.5 | same-strand | UvrD-like helicase C-terminal domain |
| 15 | PF13245.8 | 0.67 | 51 | 5221.0 | same-strand | AAA domain |
| 16 | PF13538.8 | 0.68 | 52 | 5221 | same-strand | UvrD-like helicase C-terminal domain |
++ More..