Result : P64662
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein jhp_0507 |
| NCBI Accession ID | AE001439.1 |
| Organism | Helicobacter pylori (strain J99 / ATCC 700824) (Campylobacter pylori J99) |
| Left | 557484 |
| Right | 557564 |
| Strand | - |
| Nucleotide Sequence | ATGGGGATTATTTACTTAATATTGTTTCTCATTGTAATTTATTTGTTGTATAGGATTTTAGATGTTTTGGAGCAAAAATAA |
| Sequence | MGIIYLILFLIVIYLLYRILDVLEQK |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 9923682 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P64662 |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 551269 | 551349 | - | NC_017379.1 | Helicobacter pylori Puno135 |
| 2 | 676362 | 676442 | - | NC_008229.1 | Helicobacter acinonychis str. Sheeba |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_017379.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03255.16 | 1.0 | 2 | 1759.0 | same-strand | Acetyl co-enzyme A carboxylase carboxyltransferase alpha subunit |
| 2 | PF00109.28 | 1.0 | 2 | 497.5 | same-strand | Beta-ketoacyl synthase, N-terminal domain |
| 3 | PF02801.24 | 1.0 | 2 | 497.5 | same-strand | Beta-ketoacyl synthase, C-terminal domain |
| 4 | PF00550.27 | 1.0 | 2 | 51.0 | same-strand | Phosphopantetheine attachment site |
| 5 | PF13561.8 | 1.0 | 2 | 93.0 | same-strand | Enoyl-(Acyl carrier protein) reductase |
| 6 | PF00106.27 | 1.0 | 2 | 93.0 | same-strand | short chain dehydrogenase |
| 7 | PF08659.12 | 1.0 | 2 | 93.0 | same-strand | KR domain |
| 8 | PF01165.22 | 1.0 | 2 | 871.5 | same-strand | Ribosomal protein S21 |
| 9 | PF04224.14 | 1.0 | 2 | 2878.0 | same-strand | Protein of unknown function, DUF417 |
++ More..