| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Probable DNA-binding protein HU |
| NCBI Accession ID | AE001273.1 |
| Organism | Chlamydia trachomatis (strain D/UW-3/Cx) |
| Left | 298811 |
| Right | 299113 |
| Strand | - |
| Nucleotide Sequence | ATGGCAACGATGACTAAGAAGAAACTAATCAGTACGATATCTCAAGATCATAAAATACATCCTAACCACGTGAGAACTGTTATCCAAAATTTTTTAGATAAGATGACAGATGCTCTAGTTCAAGGGGATAGATTAGAGTTTAGAGACTTTGGAGTTCTACAAGTTGTAGAGAGAAAGCCAAAAGTTGGTCGTAACCCTAAAAATGCAGCAGTACCTATCCATATTCCTGCTAGAAGAGCTGTGAAGTTCACTCCTGGCAAAAGAATGAAACGTTTGATTGAAACACCAACAAAATCTTCTTAG |
| Sequence | MATMTKKKLISTISQDHKIHPNHVRTVIQNFLDKMTDALVQGDRLEFRDFGVLQVVERKPKVGRNPKNAAVPIHIPARRAVKFTPGKRMKRLIETPTKSS |
| Source of smORF | Swiss-Prot |
| Function | Histone-like DNA-binding protein which is capable of wrapping DNA to stabilize it, and thus to prevent its denaturation under extreme environmental conditions. {ECO:0000250}. |
| Pubmed ID | 9784136 |
| Domain | CDD:412265 |
| Functional Category | DNA-binding |
| Uniprot ID | P64386 |
| ORF Length (Amino Acid) | 100 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 298811 | 299113 | - | NC_000117.1 | Chlamydia trachomatis D/UW-3/CX |
| 2 | 332180 | 332482 | - | NZ_LS398098.1 | Chlamydia suis |
| 3 | 648951 | 649253 | - | NC_002620.2 | Chlamydia muridarum str. Nigg |
| 4 | 817086 | 817388 | + | NZ_CP015840.1 | Chlamydia gallinacea 08-1274/3 |
| 5 | 405939 | 406241 | + | NC_022439.1 | Chlamydia pecorum PV3056/3 |
| 6 | 459054 | 459356 | - | NC_005043.1 | Chlamydia pneumoniae TW-183 |
| 7 | 735045 | 735347 | - | NC_007899.1 | Chlamydia felis Fe/C-56 |
| 8 | 428193 | 428495 | + | NC_017287.1 | Chlamydia psittaci 6BC |
| 9 | 428599 | 428901 | + | NC_003361.3 | Chlamydia caviae GPIC |
| 10 | 1497971 | 1498249 | + | NC_015702.1 | Parachlamydia acanthamoebae UV-7 |
| 11 | 1429131 | 1429436 | - | NC_014225.1 | Waddlia chondrophila WSU 86-1044 |
| 12 | 830080 | 830406 | + | NC_015713.1 | Simkania negevensis Z |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02621.16 | 0.75 | 9 | 4942 | opposite-strand | Menaquinone biosynthesis |
| 2 | PF00005.29 | 1.0 | 12 | 2364.0 | same-strand | ABC transporter |
| 3 | PF03255.16 | 1.0 | 12 | 1415.5 | same-strand | Acetyl co-enzyme A carboxylase carboxyltransferase alpha subunit |
| 4 | PF01520.20 | 0.75 | 9 | 362 | same-strand | N-acetylmuramoyl-L-alanine amidase |
| 5 | PF08245.14 | 0.75 | 9 | 1051 | same-strand | Mur ligase middle domain |
| 6 | PF02875.23 | 0.75 | 9 | 1051 | same-strand | Mur ligase family, glutamate ligase domain |
| 7 | PF00905.24 | 0.75 | 9 | 2799 | same-strand | Penicillin binding protein transpeptidase domain |
| 8 | PF00664.25 | 0.67 | 8 | 2373.0 | same-strand | ABC transporter transmembrane region |