Result : P63772
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 10 kDa chaperonin (GroES protein) (Protein Cpn10) |
| NCBI Accession ID | AE009949.1 |
| Organism | Streptococcus pyogenes serotype M18 (strain MGAS8232) |
| Left | 1779759 |
| Right | 1780049 |
| Strand | - |
| Nucleotide Sequence | ATGTTAAAACCATTAGGTGACCGTGTGGTCGTAAGATTTGATGATGAAAAAGAGCAGACAGTCGGTGGTTTTGTCCTTGCAGGCACTCATAAAGAGTCAACACGAAAAGCGACAGTCCTCGCTGTCAGTGAAACGGGTGTTCGCACTATTACAGGCGATAGCGTGCTACCTTCAGTTTCAGTGGGTCAAGAGGTTTTAGTTGAAAATGGGCATGATTTAGAAGTAACCGTAGATGATGAGAAAGTTTCTATCATCCGTGAATCTGACATCATTGCTATTGTTACAAAATAA |
| Sequence | MLKPLGDRVVVRFDDEKEQTVGGFVLAGTHKESTRKATVLAVSETGVRTITGDSVLPSVSVGQEVLVENGHDLEVTVDDEKVSIIRESDIIAIVTK |
| Source of smORF | Swiss-Prot |
| Function | Binds to Cpn60 in the presence of Mg-ATP and suppresses the ATPase activity of the latter. {ECO:0000255|HAMAP-Rule:MF_00580}. |
| Pubmed ID | 11917108 |
| Domain | CDD:415587 |
| Functional Category | Others |
| Uniprot ID | P63772 |
| ORF Length (Amino Acid) | 96 |
++ More..
| Conservation Analysis |
No. of Species: 35
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1664513 | 1664803 | - | NZ_CP010450.1 | Streptococcus pyogenes |
| 2 | 2040504 | 2040794 | - | NZ_LR594046.1 | Streptococcus dysgalactiae |
| 3 | 724750 | 725040 | + | NZ_LR134293.1 | Streptococcus canis |
| 4 | 1855956 | 1856246 | - | NZ_LR594050.1 | Streptococcus porcinus |
| 5 | 1330358 | 1330648 | + | NZ_LR134341.1 | Streptococcus pseudoporcinus |
| 6 | 1881084 | 1881371 | - | NZ_CP065061.1 | Streptococcus equi subsp. zooepidemicus |
| 7 | 143665 | 143949 | + | NZ_CP039457.1 | Streptococcus pasteurianus |
| 8 | 936647 | 936931 | + | NZ_CP054015.1 | Streptococcus gallolyticus |
| 9 | 123729 | 124013 | + | NZ_LS483403.1 | Streptococcus lutetiensis |
| 10 | 1930753 | 1931037 | - | NZ_LR134512.1 | Streptococcus agalactiae |
| 11 | 1963663 | 1963947 | - | NZ_CP029491.1 | Streptococcus sobrinus |
| 12 | 136351 | 136632 | + | NZ_AP018400.1 | Streptococcus ruminantium |
| 13 | 172447 | 172731 | + | NZ_CP025536.1 | Streptococcus pluranimalium |
| 14 | 237422 | 237709 | + | NC_017581.1 | Streptococcus thermophilus JIM 8232 |
| 15 | 133787 | 134068 | + | NC_012924.1 | Streptococcus suis SC84 |
| 16 | 212313 | 212585 | + | NZ_LR134275.1 | Streptococcus vestibularis |
| 17 | 1808274 | 1808561 | + | NZ_CP013237.1 | Streptococcus mutans |
| 18 | 231956 | 232243 | + | NZ_AP014612.1 | Streptococcus troglodytae |
| 19 | 1432243 | 1432527 | - | NZ_CP014835.1 | Streptococcus halotolerans |
| 20 | 360146 | 360430 | - | NZ_CP032620.1 | Streptococcus koreensis |
| 21 | 1842401 | 1842685 | - | NC_015875.1 | Streptococcus pseudopneumoniae IS7493 |
| 22 | 1382701 | 1382985 | - | NZ_CP032621.1 | Streptococcus gwangjuense |
| 23 | 320026 | 320310 | + | NZ_LS483343.1 | Streptococcus ferus |
| 24 | 868686 | 868973 | + | NZ_CP043405.1 | Streptococcus ratti |
| 25 | 1531898 | 1532182 | - | NZ_LR134336.1 | Streptococcus oralis ATCC 35037 |
| 26 | 771836 | 772120 | + | NZ_CP016953.1 | Streptococcus himalayensis |
| 27 | 669597 | 669881 | - | NZ_CP015196.1 | Streptococcus marmotae |
| 28 | 1793970 | 1794251 | - | NZ_LS483383.1 | Streptococcus cristatus ATCC 51100 |
| 29 | 277275 | 277556 | + | NZ_CP012805.1 | Streptococcus anginosus |
| 30 | 235916 | 236197 | + | NZ_CP034543.1 | Streptococcus periodonticum |
| 31 | 2238964 | 2239248 | + | NZ_CP014699.1 | Streptococcus pantholopis |
| 32 | 156171 | 156455 | + | NZ_CP031733.1 | Streptococcus chenjunshii |
| 33 | 1661099 | 1661380 | - | NZ_LS483436.1 | Streptococcus intermedius |
| 34 | 545200 | 545484 | + | NZ_CP022680.1 | Streptococcus respiraculi |
| 35 | 1945898 | 1946179 | - | NZ_LR594049.1 | Streptococcus gordonii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP010450.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00118.26 | 1.0 | 35 | 40 | same-strand | TCP-1/cpn60 chaperonin family |
++ More..