Result : P62551
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Positive regulator of RepFIC repA1 expression (repA1 leader peptide) |
| NCBI Accession ID | AL391753.1 |
| Organism | Shigella flexneri |
| Left | 203039 |
| Right | 203113 |
| Strand | + |
| Nucleotide Sequence | ATGCCCGGAAAAGTTCAAGACTTCTTTCTGTGCTCGCTCCTTCTGCGCATTGTAAGTGCAGGATGGTGTGACTGA |
| Sequence | MPGKVQDFFLCSLLLRIVSAGWCD |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of PRK13716. Profile Description: RepA leader peptide Tap. |
| Pubmed ID | 11115111 11292750 12384590 14573649 |
| Domain | CDD:106657 |
| Functional Category | Others |
| Uniprot ID | P62551 |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 209381 | 209455 | + | NC_004851.1 | Shigella flexneri 2a str. 301 |
| 2 | 730 | 804 | + | NC_013717.1 | Citrobacter rodentium ICC168 |
| 3 | 72489 | 72563 | + | NC_002128.1 | Escherichia coli O157:H7 str. Sakai |
| 4 | 72869 | 72946 | + | NZ_CP041249.1 | Raoultella electrica |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_004851.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF10723.11 | 1.0 | 4 | 230.0 | same-strand | Replication regulatory protein RepB |
++ More..