Protein Information |
Information Type | Description |
---|---|
Protein name | Positive regulator of RepFIC repA1 expression (repA1 leader peptide) |
NCBI Accession ID | AL391753.1 |
Organism | Shigella flexneri |
Left | 203039 |
Right | 203113 |
Strand | + |
Nucleotide Sequence | ATGCCCGGAAAAGTTCAAGACTTCTTTCTGTGCTCGCTCCTTCTGCGCATTGTAAGTGCAGGATGGTGTGACTGA |
Sequence | MPGKVQDFFLCSLLLRIVSAGWCD |
Source of smORF | Swiss-Prot |
Function | The ORF matches to the profile of PRK13716. Profile Description: RepA leader peptide Tap. |
Pubmed ID | 11115111 11292750 12384590 14573649 |
Domain | CDD:106657 |
Functional Category | Others |
Uniprot ID | P62551 |
ORF Length (Amino Acid) | 24 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 209381 | 209455 | + | NC_004851.1 | Shigella flexneri 2a str. 301 |
2 | 730 | 804 | + | NC_013717.1 | Citrobacter rodentium ICC168 |
3 | 72489 | 72563 | + | NC_002128.1 | Escherichia coli O157:H7 str. Sakai |
4 | 72869 | 72946 | + | NZ_CP041249.1 | Raoultella electrica |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF10723.11 | 1.0 | 4 | 230.0 | same-strand | Replication regulatory protein RepB |