Result : P62526
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | ilv operon leader peptide (ilvGMEDA operon attenuator peptide) |
| NCBI Accession ID | AL513382.1 |
| Organism | Salmonella typhi |
| Left | 3514746 |
| Right | 3514844 |
| Strand | - |
| Nucleotide Sequence | ATGACAGCCCTTCTACGAGTGATTAGCCTGGTCGTGATTAGCGTGGTGGTGATTATTATCCCACCGTGCGGGGCTGCACTTGGACGAGGAAAGGCTTAG |
| Sequence | MTALLRVISLVVISVVVIIIPPCGAALGRGKA |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of PRK10424. Profile Description: ilv operon leader peptide. |
| Pubmed ID | 11677608 12644504 |
| Domain | CDD:170429 |
| Functional Category | Others |
| Uniprot ID | P62526 |
| ORF Length (Amino Acid) | 32 |
++ More..
| Conservation Analysis |
No. of Species: 79
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3917442 | 3917540 | + | NZ_AP014857.1 | Escherichia albertii |
| 2 | 4558933 | 4559031 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 3 | 3758447 | 3758545 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 4 | 2622582 | 2622680 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 5 | 2725603 | 2725701 | + | NZ_CP033744.1 | Citrobacter freundii |
| 6 | 2364580 | 2364678 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 7 | 3371197 | 3371295 | - | NZ_CP038469.1 | Citrobacter tructae |
| 8 | 4208211 | 4208309 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 9 | 1160427 | 1160525 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 10 | 117000 | 117098 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 11 | 5979347 | 5979445 | - | NZ_CP036175.1 | Klebsiella huaxiensis |
| 12 | 6000646 | 6000744 | - | NZ_CP060111.1 | Klebsiella michiganensis |
| 13 | 5437466 | 5437564 | - | NZ_CP050508.1 | Raoultella terrigena |
| 14 | 5415025 | 5415123 | - | NZ_CP046672.1 | Raoultella ornithinolytica |
| 15 | 5372460 | 5372558 | - | NZ_CP054254.1 | Klebsiella variicola |
| 16 | 4743892 | 4743990 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 17 | 1895025 | 1895123 | + | NZ_CP026047.1 | Raoultella planticola |
| 18 | 729107 | 729205 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 19 | 129255 | 129353 | + | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 20 | 5080182 | 5080280 | - | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 21 | 5130994 | 5131092 | - | NZ_LR134475.1 | Klebsiella aerogenes |
| 22 | 4912960 | 4913058 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 23 | 4108748 | 4108846 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 24 | 2757102 | 2757200 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 25 | 4617010 | 4617108 | - | NC_015968.1 | Enterobacter soli |
| 26 | 4559315 | 4559413 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 27 | 102307 | 102405 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 28 | 3950322 | 3950420 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 29 | 4459622 | 4459720 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 30 | 3959763 | 3959861 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 31 | 2823823 | 2823921 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 32 | 4420622 | 4420720 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 33 | 1914241 | 1914339 | + | NZ_CP053416.1 | Salmonella bongori |
| 34 | 4393890 | 4393988 | - | NZ_LR134340.1 | Escherichia marmotae |
| 35 | 4279317 | 4279415 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 36 | 11359 | 11457 | + | NZ_CP017280.1 | Enterobacter ludwigii |
| 37 | 4409542 | 4409640 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 38 | 288737 | 288835 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 39 | 4526525 | 4526623 | - | NZ_CP035129.1 | Kosakonia cowanii |
| 40 | 3801418 | 3801516 | - | NZ_CP023567.1 | Erwinia pyrifoliae |
| 41 | 187137 | 187235 | + | NC_013961.1 | Erwinia amylovora CFBP1430 |
| 42 | 3457747 | 3457842 | - | NZ_FO704551.1 | Xenorhabdus poinarii G6 |
| 43 | 2997015 | 2997113 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 44 | 5483092 | 5483190 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 45 | 139310 | 139408 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 46 | 3292452 | 3292550 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 47 | 5243763 | 5243861 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 48 | 5116588 | 5116686 | - | NZ_CP041247.1 | Raoultella electrica |
| 49 | 512256 | 512354 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 50 | 3309813 | 3309911 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 51 | 4408471 | 4408569 | - | NZ_LR134373.1 | Yersinia pseudotuberculosis |
| 52 | 2091020 | 2091118 | - | NZ_CP011078.1 | Yersinia ruckeri |
| 53 | 1791079 | 1791177 | + | NZ_CP007230.1 | Yersinia similis |
| 54 | 4516419 | 4516517 | - | NZ_CP011118.1 | Yersinia enterocolitica |
| 55 | 1038054 | 1038152 | - | NZ_CP054043.1 | Yersinia mollaretii ATCC 43969 |
| 56 | 4474648 | 4474746 | - | NZ_LR134201.1 | Cedecea lapagei |
| 57 | 1532543 | 1532641 | - | NZ_CP042941.1 | Atlantibacter hermannii |
| 58 | 4525014 | 4525112 | - | NZ_CP045845.1 | Kluyvera intermedia |
| 59 | 4518477 | 4518575 | - | NZ_CP046293.1 | Yersinia intermedia |
| 60 | 2514651 | 2514749 | - | NZ_CP009781.1 | Yersinia aldovae 670-83 |
| 61 | 4159850 | 4159942 | - | NZ_CP072455.1 | Xenorhabdus budapestensis |
| 62 | 166736 | 166834 | + | NZ_CP032487.1 | Yersinia hibernica |
| 63 | 163511 | 163609 | + | NZ_CP043727.1 | Yersinia canariae |
| 64 | 3055810 | 3055908 | + | NZ_CP009787.1 | Yersinia rohdei |
| 65 | 220180 | 220278 | + | NC_010694.1 | Erwinia tasmaniensis Et1/99 |
| 66 | 4898568 | 4898666 | - | NZ_CP023525.1 | Cedecea neteri |
| 67 | 4359167 | 4359265 | - | NZ_AP023184.1 | Buttiauxella agrestis |
| 68 | 1542501 | 1542599 | - | NZ_CP011254.1 | Serratia fonticola |
| 69 | 4839851 | 4839949 | - | NC_012962.1 | Photorhabdus asymbiotica |
| 70 | 4073964 | 4074065 | - | NZ_LS483422.1 | Providencia heimbachae |
| 71 | 5248273 | 5248371 | - | NC_015567.1 | Serratia plymuthica AS9 |
| 72 | 5072640 | 5072738 | - | NZ_CP038662.1 | Serratia nematodiphila |
| 73 | 5020277 | 5020375 | - | NZ_LT906479.1 | Serratia ficaria |
| 74 | 4284839 | 4284937 | - | NZ_CP016948.1 | Serratia surfactantfaciens |
| 75 | 120438 | 120536 | + | NZ_CP071320.1 | Serratia ureilytica |
| 76 | 310948 | 311049 | + | NZ_CP006569.1 | Sodalis praecaptivus |
| 77 | 143165 | 143263 | + | NZ_CP050150.1 | Hafnia alvei |
| 78 | 4034768 | 4034866 | - | NC_013892.1 | Xenorhabdus bovienii SS-2004 |
| 79 | 3535953 | 3536054 | - | NZ_CP031123.2 | Providencia huaxiensis |
| 80 | 1002972 | 1003073 | + | NZ_CP029736.1 | Providencia rettgeri |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP014857.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00126.29 | 0.97 | 77 | 2355.0 | opposite-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 2 | PF03466.22 | 0.95 | 75 | 2355.0 | opposite-strand | LysR substrate binding domain |
| 3 | PF04219.14 | 0.99 | 78 | 1898 | same-strand | Protein of unknown function, DUF |
| 4 | PF01078.23 | 0.99 | 78 | 353 | opposite-strand | Magnesium chelatase, subunit ChlI |
| 5 | PF13541.8 | 0.97 | 77 | 353.0 | opposite-strand | Subunit ChlI of Mg-chelatase |
| 6 | PF13335.8 | 1.0 | 79 | 353.0 | opposite-strand | Magnesium chelatase, subunit ChlI C-terminal |
| 7 | PF07728.16 | 1.0 | 79 | 353.0 | opposite-strand | AAA domain (dynein-related subfamily) |
| 8 | PF02776.20 | 1.0 | 79 | 140.0 | same-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
| 9 | PF02775.23 | 1.0 | 79 | 140.0 | same-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
| 10 | PF00205.24 | 1.0 | 79 | 140.0 | same-strand | Thiamine pyrophosphate enzyme, central domain |
| 11 | PF13710.8 | 1.0 | 79 | 1783.0 | same-strand | ACT domain |
| 12 | PF13291.8 | 0.8 | 63 | 1783.0 | same-strand | ACT domain |
| 13 | PF01063.21 | 1.0 | 79 | 2065.0 | same-strand | Amino-transferase class IV |
| 14 | PF00920.23 | 1.0 | 79 | 3060.5 | same-strand | Dehydratase family |
| 15 | PF00291.27 | 1.0 | 79 | 4914 | same-strand | Pyridoxal-phosphate dependent enzyme |
| 16 | PF00585.20 | 1.0 | 79 | 4914 | same-strand | C-terminal regulatory domain of Threonine dehydratase |
++ More..