Result : P62187
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Erythromycin resistance leader peptide (23S rRNA methylase leader peptide) |
| NCBI Accession ID | L08389.1 |
| Organism | Bacillus anthracis |
| Left | 70 |
| Right | 114 |
| Strand | + |
| Nucleotide Sequence | ATGACACACTCAATGAGACTGCGTTTCCCAACTTTGAACCAGTAA |
| Sequence | MTHSMRLRFPTLNQ |
| Source of smORF | Swiss-Prot |
| Function | This peptide is involved in the control mechanism of the synthesis of the macrolide-lincosamide-streptogramin B resistance protein. It acts as a transcriptional attenuator. |
| Pubmed ID | 8473865 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P62187 |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2867620 | 2867664 | + | NZ_CP023665.1 | Bacillus paralicheniformis |
| 2 | 3786635 | 3786679 | - | NZ_CP065425.1 | Heyndrickxia vini |
| 3 | 1387498 | 1387542 | - | NZ_CP038012.1 | Sporosarcina pasteurii |
| 4 | 4174817 | 4174861 | - | NZ_CP004078.1 | Paenibacillus sabinae T27 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP023665.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF08241.14 | 0.75 | 3 | 680.5 | same-strand | Methyltransferase domain |
++ More..