Result : P60997
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | his operon leader peptide (his operon attenuator peptide) |
| NCBI Accession ID | V01371.1 |
| Organism | Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) |
| Left | 58 |
| Right | 108 |
| Strand | + |
| Nucleotide Sequence | ATGACACGCGTTCAATTTAAACACCACCATCATCACCATCATCCTGACTAG |
| Sequence | MTRVQFKHHHHHHHPD |
| Source of smORF | Swiss-Prot |
| Function | This protein is involved in the attenuation mechanism for the control of the expression of the his operon structural genes. {ECO:0000250}. |
| Pubmed ID | 360216 3062174 11677609 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P60997 |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 25
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3240643 | 3240693 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 2 | 2495213 | 2495263 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 3 | 1940221 | 1940271 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 4 | 2252616 | 2252666 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 5 | 3303363 | 3303413 | + | NZ_CP043318.1 | Enterobacter chengduensis |
| 6 | 4349793 | 4349843 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 7 | 4954774 | 4954824 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 8 | 3056369 | 3056419 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 9 | 11459 | 11509 | - | NZ_CP016337.1 | Kosakonia sacchari |
| 10 | 495611 | 495661 | - | NZ_CP045769.1 | Enterobacter cancerogenus |
| 11 | 2149415 | 2149465 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 12 | 2276384 | 2276434 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 13 | 4258273 | 4258323 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 14 | 2966922 | 2966972 | + | NC_015968.1 | Enterobacter soli |
| 15 | 1705837 | 1705887 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
| 16 | 2983284 | 2983334 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
| 17 | 742689 | 742739 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 18 | 3029553 | 3029603 | + | NZ_CP027986.1 | Enterobacter sichuanensis |
| 19 | 2065658 | 2065708 | + | NZ_AP014857.1 | Escherichia albertii |
| 20 | 2089996 | 2090046 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 21 | 3009964 | 3010014 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 22 | 1077549 | 1077599 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 23 | 154844 | 154894 | + | NZ_CP053416.1 | Salmonella bongori |
| 24 | 2641397 | 2641447 | + | NZ_LR134340.1 | Escherichia marmotae |
| 25 | 182488 | 182538 | + | NZ_CP042941.1 | Atlantibacter hermannii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP043318.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00768.22 | 0.64 | 16 | 5327.5 | opposite-strand | D-alanyl-D-alanine carboxypeptidase |
| 2 | PF07943.15 | 0.64 | 16 | 5327.5 | opposite-strand | Penicillin-binding protein 5, C-terminal domain |
| 3 | PF13354.8 | 0.64 | 16 | 5327.5 | opposite-strand | Beta-lactamase enzyme family |
| 4 | PF08411.12 | 0.8 | 20 | 3714.0 | same-strand | Exonuclease C-terminal |
| 5 | PF00929.26 | 0.8 | 20 | 3714.0 | same-strand | Exonuclease |
| 6 | PF13520.8 | 1.0 | 25 | 2241 | opposite-strand | Amino acid permease |
| 7 | PF00324.23 | 1.0 | 25 | 2241 | opposite-strand | Amino acid permease |
| 8 | PF01370.23 | 0.92 | 23 | 176 | opposite-strand | NAD dependent epimerase/dehydratase family |
| 9 | PF01634.20 | 1.0 | 25 | 145 | same-strand | ATP phosphoribosyltransferase |
| 10 | PF08029.13 | 1.0 | 25 | 145 | same-strand | HisG, C-terminal domain |
| 11 | PF00815.22 | 1.0 | 25 | 1050 | same-strand | Histidinol dehydrogenase |
| 12 | PF00155.23 | 1.0 | 25 | 2351 | same-strand | Aminotransferase class I and II |
| 13 | PF00475.20 | 1.0 | 25 | 3409 | same-strand | Imidazoleglycerol-phosphate dehydratase |
| 14 | PF03466.22 | 0.8 | 20 | 1042.0 | opposite-strand | LysR substrate binding domain |
| 15 | PF00126.29 | 0.8 | 20 | 1042.0 | opposite-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
++ More..