Result : P54468
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein YqfC |
| NCBI Accession ID | D84432.1 |
| Organism | Bacillus subtilis (strain 168) |
| Left | 102657 |
| Right | 102938 |
| Strand | + |
| Nucleotide Sequence | ATGGGGCAAAGAAAGAATCGTATGAAAGCTTGGCTGACAAGAGCATTGGAAATTCCCCCGGACGTTATGATGGATCTGCCGAGGATTACAATGGTTGGCAGACTTCATATCTACATAGAAAACCACAGAGGCCTTTTGCTTTTCAGTGAGAATGAAGTGCGGCTGATGCTGAAGCAGGGCCAGTGCATCATATCTGGTAAAAATTTTGTCATCAAGGCGATTCTTCCGGAAGAGATACTTTTGGAGGGTACGATTGATGTCGTTCGATATGTTGAGTCATAA |
| Sequence | MGQRKNRMKAWLTRALEIPPDVMMDLPRITMVGRLHIYIENHRGLLLFSENEVRLMLKQGQCIISGKNFVIKAILPEEILLEGTIDVVRYVES |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl06766. Profile Description: YabP family. Members of this protein family are the YabP protein of the bacterial sporulation program, as found in Bacillus subtilis, Clostridium tetani, and other spore-forming members of the Firmicutes. In Bacillus subtilis, a yabP single mutant appears to sporulate and germinate normally (), but is in an operon with yabQ (essential for formation of the spore cortex), it near-universal among endospore-forming bacteria, and is found nowhere else. It is likely, therefore, that YabP does have a function in sporulation or germination, one that is either unappreciated or partially redundant with that of another protein. [Cellular processes, Sporulation and germination] |
| Pubmed ID | 8969508 9384377 |
| Domain | CDD:414893 |
| Functional Category | Others |
| Uniprot ID | P54468 |
| ORF Length (Amino Acid) | 93 |
++ More..
| Conservation Analysis |
No. of Species: 60
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2490096 | 2490377 | - | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 2 | 2616667 | 2616948 | - | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 3 | 3640975 | 3641256 | + | NZ_CP029364.1 | Bacillus halotolerans |
| 4 | 2488765 | 2489046 | - | NZ_CP048852.1 | Bacillus tequilensis |
| 5 | 2475660 | 2475941 | - | NZ_CP013984.1 | Bacillus inaquosorum |
| 6 | 2585029 | 2585310 | - | NZ_CP033052.1 | Bacillus vallismortis |
| 7 | 2413263 | 2413544 | - | NZ_CP051464.1 | Bacillus mojavensis |
| 8 | 1436095 | 1436376 | + | NZ_CP011937.1 | Bacillus velezensis |
| 9 | 2563570 | 2563851 | - | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 10 | 2782830 | 2783111 | - | NZ_CP023665.1 | Bacillus paralicheniformis |
| 11 | 2624069 | 2624350 | - | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 12 | 2976000 | 2976281 | + | NZ_CP043404.1 | Bacillus safensis |
| 13 | 3064700 | 3064981 | + | NZ_CP017786.1 | Bacillus xiamenensis |
| 14 | 2310846 | 2311127 | - | NZ_CP011150.1 | Bacillus altitudinis |
| 15 | 2895584 | 2895865 | - | NZ_LT603683.1 | Bacillus glycinifermentans |
| 16 | 2279688 | 2279972 | - | NZ_CP012024.1 | Bacillus smithii |
| 17 | 3362226 | 3362462 | - | NC_022524.1 | Bacillus infantis NRRL B-14911 |
| 18 | 1615349 | 1615591 | + | NZ_CP065425.1 | Heyndrickxia vini |
| 19 | 2132018 | 2132278 | - | NZ_CP064060.1 | Anoxybacillus caldiproteolyticus |
| 20 | 3468579 | 3468815 | + | NZ_CP022983.1 | Cytobacillus kochii |
| 21 | 3367759 | 3367995 | + | NZ_CP041305.1 | Cytobacillus ciccensis |
| 22 | 3114306 | 3114542 | - | NZ_CP018866.1 | Sutcliffiella cohnii |
| 23 | 1304852 | 1305142 | + | NZ_CP016020.1 | Bacillus weihaiensis |
| 24 | 4290633 | 4290872 | - | NC_011725.1 | Bacillus cereus B4264 |
| 25 | 4121748 | 4122023 | - | NC_007530.2 | Bacillus anthracis str. 'Ames Ancestor' |
| 26 | 4157327 | 4157560 | - | NZ_CP064875.1 | Bacillus toyonensis |
| 27 | 1076776 | 1077009 | + | NZ_CP040336.1 | Bacillus luti |
| 28 | 3457709 | 3457957 | - | NZ_CP053989.1 | Niallia circulans |
| 29 | 1443070 | 1443306 | + | NZ_CP070511.1 | Parageobacillus toebii |
| 30 | 1150607 | 1150846 | + | NC_013791.2 | Alkalihalobacillus pseudofirmus OF4 |
| 31 | 1957076 | 1957312 | - | NZ_CP012152.1 | Anoxybacillus gonensis |
| 32 | 3408142 | 3408378 | - | NZ_CP042593.1 | Bacillus dafuensis |
| 33 | 3437587 | 3437823 | - | NZ_CP016622.1 | Parageobacillus thermoglucosidasius |
| 34 | 730134 | 730370 | - | NZ_CP030926.1 | Peribacillus butanolivorans |
| 35 | 3076133 | 3076372 | - | NZ_CP024109.1 | Bacillus cytotoxicus |
| 36 | 765074 | 765331 | + | NZ_CP014342.1 | Geobacillus subterraneus |
| 37 | 767748 | 767984 | - | NZ_CP009709.1 | Weizmannia coagulans DSM 1 = ATCC 7050 |
| 38 | 2569170 | 2569451 | - | NZ_CP015438.1 | Anoxybacillus amylolyticus |
| 39 | 4330618 | 4330851 | - | NZ_CP032365.1 | Bacillus wiedmannii |
| 40 | 2514880 | 2515128 | - | NC_006510.1 | Geobacillus kaustophilus HTA426 |
| 41 | 1715719 | 1715967 | - | NZ_CP061470.1 | Geobacillus zalihae |
| 42 | 1421473 | 1421721 | + | NZ_CP018058.1 | Geobacillus thermocatenulatus |
| 43 | 3422387 | 3422635 | + | NZ_CP061472.1 | Geobacillus thermoleovorans |
| 44 | 4430829 | 4431065 | + | NZ_CP017704.1 | Peribacillus simplex NBRC 15720 = DSM 1321 |
| 45 | 4057140 | 4057376 | + | NZ_CP068053.1 | Peribacillus psychrosaccharolyticus |
| 46 | 1681827 | 1682063 | + | NZ_LS483476.1 | Lederbergia lentus |
| 47 | 2526239 | 2526499 | - | NZ_CP023704.1 | Caldibacillus thermoamylovorans |
| 48 | 4315369 | 4315605 | - | NZ_CP024035.1 | Priestia aryabhattai |
| 49 | 69131 | 69361 | - | NZ_CP063356.1 | Anaerobacillus isosaccharinicus |
| 50 | 3802656 | 3802940 | - | NZ_CP017703.1 | Aeribacillus pallidus |
| 51 | 1444802 | 1445029 | + | NC_002570.2 | Alkalihalobacillus halodurans C-125 |
| 52 | 1794826 | 1795122 | + | NC_014829.1 | Evansella cellulosilytica DSM 2522 |
| 53 | 2773378 | 2773659 | - | NZ_CP015378.1 | Fictibacillus phosphorivorans |
| 54 | 2258481 | 2258780 | - | NZ_CP029797.1 | Paraliobacillus zengyii |
| 55 | 2047245 | 2047526 | - | NZ_CP041666.1 | Radiobacillus deserti |
| 56 | 1789390 | 1789671 | - | NZ_CP008876.1 | Terribacillus goriensis |
| 57 | 3827961 | 3828257 | - | NZ_CP026363.1 | Brevibacillus agri |
| 58 | 4018803 | 4019099 | - | NZ_LR134338.1 | Brevibacillus brevis |
| 59 | 1407141 | 1407371 | + | NZ_AP017312.1 | Aneurinibacillus soli |
| 60 | 1117613 | 1117894 | - | NZ_CP013862.1 | Lentibacillus amyloliquefaciens |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP029364.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02130.19 | 1.0 | 60 | 4400.5 | same-strand | Endoribonuclease YbeY |
| 2 | PF07698.13 | 0.92 | 55 | 2276 | same-strand | 7TM receptor with intracellular HD hydrolase |
| 3 | PF07697.13 | 0.92 | 55 | 2276 | same-strand | 7TM-HD extracellular |
| 4 | PF01966.24 | 0.93 | 56 | 2278.0 | same-strand | HD domain |
| 5 | PF02562.18 | 1.0 | 60 | 1212.0 | same-strand | PhoH-like protein |
| 6 | PF13245.8 | 1.0 | 60 | 1212.0 | same-strand | AAA domain |
| 7 | PF06898.13 | 1.0 | 60 | 19.0 | same-strand | Putative stage IV sporulation protein YqfD |
| 8 | PF12127.10 | 0.72 | 43 | 634 | same-strand | SigmaW regulon antibacterial |
| 9 | PF01957.20 | 0.72 | 43 | 1663 | same-strand | NfeD-like C-terminal, partner-binding |
| 10 | PF09424.12 | 0.98 | 59 | 2975 | same-strand | Yqey-like protein |
| 11 | PF01165.22 | 0.87 | 52 | 3431.0 | same-strand | Ribosomal protein S21 |
| 12 | PF01219.21 | 0.88 | 53 | 4897 | same-strand | Prokaryotic diacylglycerol kinase |
++ More..