Result : P54454
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Probable RNA-binding protein YqeI |
| NCBI Accession ID | D84432.1 |
| Organism | Bacillus subtilis (strain 168) |
| Left | 74978 |
| Right | 75268 |
| Strand | + |
| Nucleotide Sequence | ATGTTAACAGGTAAACAAAAACGTTTTTTGCGTTCAAAAGCGCATCATTTAACGCCGATTTTTCAAGTAGGTAAAGGCGGAGTAAACGACAACATGATTAAACAAATTGCTGAGGCGCTTGAAGCGAGAGAGCTGATTAAAGTCAGCGTGCTTCAGAATTGCGAAGAGGATAAAAACGATGTAGCGGAAGCTCTTGTAAAAGGAAGCCGCTCTCAATTGGTGCAGACAATCGGCAATACGATTGTGTTATATAAGGAATCAAAGGAAAATAAACAAATCGAGCTTCCTTAA |
| Sequence | MLTGKQKRFLRSKAHHLTPIFQVGKGGVNDNMIKQIAEALEARELIKVSVLQNCEEDKNDVAEALVKGSRSQLVQTIGNTIVLYKESKENKQIELP |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl00663. Profile Description: CRS1 / YhbY (CRM) domain. GFP fused to a single-domain CRM protein from maize localises to the nucleolus, suggesting that an analogous activity may have been retained in plants. A CRM domain containing protein in plant chloroplasts has been shown to function in group I and II intron splicing. In vitro experiments with an isolated maize CRM domain have shown it to have RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes. YhbY has a fold similar to that of the C-terminal domain of translation initiation factor 3 (IF3C), which binds to 16S rRNA in the 30S ribosome. |
| Pubmed ID | 8969508 9384377 |
| Domain | CDD:412505 |
| Functional Category | RNA-binding |
| Uniprot ID | P54454 |
| ORF Length (Amino Acid) | 96 |
++ More..
| Conservation Analysis |
No. of Species: 247
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2612705 | 2612995 | - | NZ_CP033052.1 | Bacillus vallismortis |
| 2 | 2517771 | 2518061 | - | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 3 | 2503332 | 2503622 | - | NZ_CP013984.1 | Bacillus inaquosorum |
| 4 | 2644346 | 2644636 | - | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 5 | 2516442 | 2516732 | - | NZ_CP048852.1 | Bacillus tequilensis |
| 6 | 1408436 | 1408726 | + | NZ_CP011937.1 | Bacillus velezensis |
| 7 | 2591219 | 2591509 | - | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 8 | 3613275 | 3613565 | + | NZ_CP029364.1 | Bacillus halotolerans |
| 9 | 2440957 | 2441247 | - | NZ_CP051464.1 | Bacillus mojavensis |
| 10 | 759869 | 760159 | - | NZ_CP030926.1 | Peribacillus butanolivorans |
| 11 | 3036194 | 3036484 | + | NZ_CP017786.1 | Bacillus xiamenensis |
| 12 | 2338977 | 2339267 | - | NZ_CP011150.1 | Bacillus altitudinis |
| 13 | 2947885 | 2948175 | + | NZ_CP043404.1 | Bacillus safensis |
| 14 | 4400134 | 4400424 | + | NZ_CP017704.1 | Peribacillus simplex NBRC 15720 = DSM 1321 |
| 15 | 3438679 | 3438969 | + | NZ_CP022983.1 | Cytobacillus kochii |
| 16 | 3150608 | 3150901 | - | NZ_CP018866.1 | Sutcliffiella cohnii |
| 17 | 3438607 | 3438897 | - | NZ_CP042593.1 | Bacillus dafuensis |
| 18 | 1586189 | 1586479 | + | NZ_CP065425.1 | Heyndrickxia vini |
| 19 | 2158292 | 2158585 | - | NZ_CP064060.1 | Anoxybacillus caldiproteolyticus |
| 20 | 1412273 | 1412563 | + | NC_002570.2 | Alkalihalobacillus halodurans C-125 |
| 21 | 2652767 | 2653057 | - | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 22 | 2813815 | 2814105 | - | NZ_CP023665.1 | Bacillus paralicheniformis |
| 23 | 2087008 | 2087310 | - | NZ_CP009416.1 | Jeotgalibacillus malaysiensis |
| 24 | 2927324 | 2927614 | - | NZ_LT603683.1 | Bacillus glycinifermentans |
| 25 | 2556453 | 2556746 | - | NZ_CP023704.1 | Caldibacillus thermoamylovorans |
| 26 | 3392024 | 3392314 | - | NC_022524.1 | Bacillus infantis NRRL B-14911 |
| 27 | 4315538 | 4315831 | - | NC_011725.1 | Bacillus cereus B4264 |
| 28 | 4145575 | 4145868 | - | NC_007530.2 | Bacillus anthracis str. 'Ames Ancestor' |
| 29 | 3491375 | 3491668 | - | NZ_CP053989.1 | Niallia circulans |
| 30 | 1417151 | 1417444 | + | NZ_CP070511.1 | Parageobacillus toebii |
| 31 | 2309149 | 2309442 | - | NZ_CP012024.1 | Bacillus smithii |
| 32 | 3100924 | 3101214 | - | NZ_CP024109.1 | Bacillus cytotoxicus |
| 33 | 4341559 | 4341858 | - | NZ_CP024035.1 | Priestia aryabhattai |
| 34 | 4354596 | 4354898 | - | NZ_CP032365.1 | Bacillus wiedmannii |
| 35 | 1052861 | 1053154 | + | NZ_CP040336.1 | Bacillus luti |
| 36 | 4181112 | 4181405 | - | NZ_CP064875.1 | Bacillus toyonensis |
| 37 | 3337807 | 3338103 | + | NZ_CP041305.1 | Cytobacillus ciccensis |
| 38 | 4025674 | 4025964 | + | NZ_CP068053.1 | Peribacillus psychrosaccharolyticus |
| 39 | 2556332 | 2556637 | - | NZ_CP031223.1 | Psychrobacillus glaciei |
| 40 | 1274947 | 1275240 | + | NZ_CP016020.1 | Bacillus weihaiensis |
| 41 | 3463474 | 3463761 | - | NZ_CP016622.1 | Parageobacillus thermoglucosidasius |
| 42 | 1075677 | 1075967 | + | NC_013791.2 | Alkalihalobacillus pseudofirmus OF4 |
| 43 | 2594748 | 2595041 | - | NZ_CP015438.1 | Anoxybacillus amylolyticus |
| 44 | 1983097 | 1983390 | - | NZ_CP012152.1 | Anoxybacillus gonensis |
| 45 | 1763886 | 1764179 | + | NC_014829.1 | Evansella cellulosilytica DSM 2522 |
| 46 | 3101123 | 3101425 | - | NZ_CP006837.1 | Lysinibacillus varians |
| 47 | 1553189 | 1553491 | + | NZ_CP019980.1 | Lysinibacillus sphaericus |
| 48 | 2807729 | 2808019 | - | NZ_CP015378.1 | Fictibacillus phosphorivorans |
| 49 | 738594 | 738887 | + | NZ_CP014342.1 | Geobacillus subterraneus |
| 50 | 102581 | 102871 | - | NZ_CP063356.1 | Anaerobacillus isosaccharinicus |
| 51 | 1742269 | 1742562 | - | NZ_CP061470.1 | Geobacillus zalihae |
| 52 | 1653252 | 1653545 | + | NZ_LS483476.1 | Lederbergia lentus |
| 53 | 1134113 | 1134403 | + | NC_018704.1 | Amphibacillus xylanus NBRC 15112 |
| 54 | 3396096 | 3396389 | + | NZ_CP061472.1 | Geobacillus thermoleovorans |
| 55 | 1309211 | 1309504 | + | NZ_CP012502.1 | Bacillus beveridgei |
| 56 | 1553075 | 1553377 | + | NZ_CP010820.1 | Lysinibacillus fusiformis |
| 57 | 2076358 | 2076648 | - | NZ_CP041666.1 | Radiobacillus deserti |
| 58 | 1380477 | 1380770 | + | NZ_CP018058.1 | Geobacillus thermocatenulatus |
| 59 | 2541126 | 2541419 | - | NC_006510.1 | Geobacillus kaustophilus HTA426 |
| 60 | 1632462 | 1632752 | + | NZ_CP017962.1 | Virgibacillus halodenitrificans |
| 61 | 2266180 | 2266470 | - | NZ_CP024848.1 | Oceanobacillus zhaokaii |
| 62 | 4129635 | 4129925 | - | NZ_LR134338.1 | Brevibacillus brevis |
| 63 | 793053 | 793343 | - | NZ_CP009709.1 | Weizmannia coagulans DSM 1 = ATCC 7050 |
| 64 | 3664748 | 3665038 | + | NZ_CP017705.1 | Brevibacillus laterosporus DSM 25 |
| 65 | 1950828 | 1951118 | + | NZ_CP022437.1 | Virgibacillus necropolis |
| 66 | 1297015 | 1297308 | + | NZ_AP017312.1 | Aneurinibacillus soli |
| 67 | 1580196 | 1580486 | - | NZ_CP045295.1 | Paenibacillus cellulositrophicus |
| 68 | 3835797 | 3836093 | - | NZ_CP017703.1 | Aeribacillus pallidus |
| 69 | 2569506 | 2569799 | - | NZ_CP014167.1 | Paenibacillus yonginensis |
| 70 | 2860609 | 2860899 | + | NZ_CP022315.1 | Virgibacillus phasianinus |
| 71 | 1349379 | 1349678 | + | NZ_CP038015.1 | Paenisporosarcina antarctica |
| 72 | 1144943 | 1145233 | - | NZ_CP013862.1 | Lentibacillus amyloliquefaciens |
| 73 | 2325163 | 2325453 | - | NZ_CP029797.1 | Paraliobacillus zengyii |
| 74 | 672647 | 672937 | + | NZ_CP045293.1 | Paenibacillus guangzhouensis |
| 75 | 1622281 | 1622574 | + | NZ_CP022657.1 | Tumebacillus algifaecis |
| 76 | 6773178 | 6773471 | - | NC_017672.3 | Paenibacillus mucilaginosus K02 |
| 77 | 879815 | 880108 | + | NZ_CP013652.1 | Paenibacillus naphthalenovorans |
| 78 | 4910691 | 4910984 | - | NZ_CP021434.1 | Tumebacillus avium |
| 79 | 1457174 | 1457473 | + | NZ_CP016537.2 | Planococcus halocryophilus |
| 80 | 3276462 | 3276767 | + | NZ_CP011388.1 | Paenibacillus swuensis |
| 81 | 441534 | 441833 | + | NZ_CP035492.1 | Paenibacillus protaetiae |
| 82 | 2012874 | 2013164 | - | NC_004193.1 | Oceanobacillus iheyensis HTE831 |
| 83 | 1675794 | 1676084 | - | NZ_CP033460.1 | Staphylococcus debuckii |
| 84 | 1487232 | 1487522 | + | NZ_CP016539.2 | Planococcus plakortidis |
| 85 | 1402355 | 1402654 | + | NZ_CP016543.2 | Planococcus donghaensis |
| 86 | 2841436 | 2841726 | + | NZ_CP034235.1 | Paenibacillus psychroresistens |
| 87 | 1317296 | 1317586 | + | NZ_CP008724.1 | Staphylococcus xylosus |
| 88 | 1575753 | 1576052 | + | NZ_CP016534.2 | Planococcus antarcticus DSM 14505 |
| 89 | 2553611 | 2553901 | - | NC_017668.1 | Halobacillus halophilus DSM 2266 |
| 90 | 1815866 | 1816156 | - | NZ_CP008876.1 | Terribacillus goriensis |
| 91 | 1239031 | 1239321 | + | NZ_LR134089.1 | Staphylococcus saprophyticus |
| 92 | 1424318 | 1424617 | + | NZ_CP016540.2 | Planococcus versutus |
| 93 | 1892893 | 1893183 | + | NZ_CP020772.1 | Halobacillus mangrovi |
| 94 | 285192 | 285491 | - | NZ_CP013661.2 | Planococcus kocurii |
| 95 | 1497630 | 1497929 | + | NZ_CP019401.1 | Planococcus faecalis |
| 96 | 1662526 | 1662819 | + | NZ_CP004078.1 | Paenibacillus sabinae T27 |
| 97 | 471600 | 471890 | + | NZ_CP018199.1 | Staphylococcus succinus |
| 98 | 1203839 | 1204129 | + | NZ_CP013659.2 | Planococcus rifietoensis |
| 99 | 1473839 | 1474129 | - | NZ_CP013114.1 | Staphylococcus equorum |
| 100 | 1078615 | 1078878 | + | NZ_LT906464.1 | Staphylococcus muscae |
| 101 | 4339249 | 4339545 | - | NZ_CP013023.1 | Paenibacillus bovis |
| 102 | 4733202 | 4733492 | - | NZ_CP043611.1 | Paenibacillus antarcticus |
| 103 | 1418387 | 1418677 | + | NZ_CP018776.1 | Staphylococcus condimenti |
| 104 | 1390285 | 1390575 | - | NZ_CP016809.1 | Paenibacillus ihbetae |
| 105 | 1451000 | 1451290 | + | NZ_CP016538.2 | Planococcus maritimus |
| 106 | 1461004 | 1461294 | + | NZ_CP059540.1 | Planococcus maritimus |
| 107 | 1129282 | 1129572 | + | NZ_LT906462.1 | Mammaliicoccus stepanovicii |
| 108 | 4653925 | 4654227 | - | NZ_AP019400.1 | Cohnella abietis |
| 109 | 59398 | 59691 | - | NZ_CP020773.1 | Staphylococcus lutrae |
| 110 | 1862511 | 1862804 | - | NZ_CP054614.1 | Paenibacillus barcinonensis |
| 111 | 4176555 | 4176845 | + | NZ_CP011058.1 | Paenibacillus beijingensis |
| 112 | 1038046 | 1038336 | + | NZ_CP022046.2 | Mammaliicoccus sciuri |
| 113 | 2908674 | 2908970 | - | NZ_AP019308.1 | Paenibacillus baekrokdamisoli |
| 114 | 1119939 | 1120229 | - | NZ_CP068061.1 | Mammaliicoccus vitulinus |
| 115 | 3420256 | 3420546 | + | NZ_CP018622.1 | Virgibacillus dokdonensis |
| 116 | 1607137 | 1607427 | - | NC_007795.1 | Staphylococcus aureus subsp. aureus NCTC 8325 |
| 117 | 3324067 | 3324357 | + | NZ_CP015108.1 | Sporosarcina ureae |
| 118 | 2969050 | 2969340 | - | NZ_CP019659.1 | Paenibacillus larvae subsp. larvae |
| 119 | 3886305 | 3886595 | - | NZ_CP026363.1 | Brevibacillus agri |
| 120 | 1120732 | 1121022 | + | NZ_CP065712.1 | Staphylococcus auricularis |
| 121 | 1978758 | 1979048 | + | NZ_CP033732.1 | Staphylococcus hominis |
| 122 | 2674061 | 2674351 | + | NZ_CP034248.1 | Paenibacillus lentus |
| 123 | 1826984 | 1827220 | + | NZ_CP009288.1 | Paenibacillus durus |
| 124 | 5172309 | 5172605 | - | NZ_CP026520.1 | Paenibacillus chitinolyticus |
| 125 | 1410148 | 1410441 | - | NC_014925.1 | Staphylococcus pseudintermedius HKU10-03 |
| 126 | 2044503 | 2044796 | + | NZ_CP023643.1 | Brochothrix thermosphacta |
| 127 | 5592118 | 5592414 | - | NC_016641.1 | Paenibacillus terrae HPL-003 |
| 128 | 791008 | 791301 | + | NZ_CP021780.1 | Paenibacillus donghaensis |
| 129 | 848220 | 848510 | - | NZ_CP041217.1 | Saccharibacillus brassicae |
| 130 | 1331509 | 1331799 | + | NZ_AP018587.1 | Staphylococcus caprae |
| 131 | 1540381 | 1540674 | - | NZ_CP054482.1 | Macrococcus bohemicus |
| 132 | 1595640 | 1595930 | - | NZ_LT906460.1 | Staphylococcus simiae |
| 133 | 482692 | 482988 | - | NZ_CP045298.1 | Paenibacillus brasilensis |
| 134 | 1837441 | 1837737 | + | NZ_CP020028.1 | Paenibacillus kribbensis |
| 135 | 2113250 | 2113543 | + | NZ_CP009285.1 | Paenibacillus borealis |
| 136 | 1215247 | 1215540 | - | NZ_CP045927.1 | Staphylococcus agnetis |
| 137 | 1747678 | 1747911 | + | NZ_CP009286.1 | Paenibacillus stellifer |
| 138 | 2109693 | 2109986 | + | NZ_CP009287.1 | Paenibacillus graminis |
| 139 | 1340819 | 1341112 | + | NZ_CP008747.1 | Staphylococcus hyicus |
| 140 | 2274730 | 2275023 | + | NZ_LN831776.1 | Paenibacillus riograndensis SBR5 |
| 141 | 1672578 | 1672868 | - | NZ_LR134304.1 | Staphylococcus schweitzeri |
| 142 | 1269333 | 1269626 | + | NZ_CP035288.1 | Staphylococcus epidermidis |
| 143 | 4006368 | 4006661 | + | NZ_CP048429.1 | Paenibacillus jilunlii |
| 144 | 3992310 | 3992603 | + | NZ_CP068595.1 | Paenibacillus sonchi |
| 145 | 2039334 | 2039627 | - | NZ_CP027770.1 | Staphylococcus felis |
| 146 | 1737009 | 1737302 | + | NZ_CP009428.1 | Paenibacillus odorifer |
| 147 | 1340478 | 1340768 | - | NZ_CP038012.1 | Sporosarcina pasteurii |
| 148 | 1343071 | 1343364 | - | NZ_CP048286.1 | Paenibacillus rhizovicinus |
| 149 | 2314047 | 2314340 | + | NZ_CP048209.1 | Paenibacillus lycopersici |
| 150 | 1285892 | 1286182 | + | NZ_CP064056.1 | Staphylococcus lloydii |
| 151 | 197498 | 197788 | - | NC_022737.1 | Staphylococcus pasteuri SP1 |
| 152 | 1271381 | 1271671 | - | NZ_CP013911.1 | Staphylococcus haemolyticus |
| 153 | 927596 | 927886 | - | NZ_CP007601.1 | Staphylococcus capitis subsp. capitis |
| 154 | 2123831 | 2124121 | - | NZ_CP017560.1 | Sporosarcina ureilytica |
| 155 | 1902520 | 1902810 | - | NZ_CP011102.1 | Listeria weihenstephanensis |
| 156 | 816562 | 816855 | + | NC_010556.1 | Exiguobacterium sibiricum 255-15 |
| 157 | 2787933 | 2788223 | + | NZ_CP034437.1 | Paenibacillus albus |
| 158 | 1971105 | 1971401 | - | NZ_CP040676.1 | Exiguobacterium mexicanum |
| 159 | 1231376 | 1231666 | + | NZ_LR134242.1 | Staphylococcus warneri |
| 160 | 1433829 | 1434119 | - | NC_013891.1 | Listeria seeligeri serovar 1/2b str. SLCC3954 |
| 161 | 1498343 | 1498633 | - | NZ_LT906444.1 | Listeria welshimeri |
| 162 | 2525860 | 2526150 | - | NC_019897.1 | Thermobacillus composti KWC4 |
| 163 | 428954 | 429253 | - | NZ_CP046314.1 | Gemella morbillorum |
| 164 | 513221 | 513520 | + | NZ_LR134484.1 | Gemella haemolysans |
| 165 | 1424638 | 1424931 | - | NZ_CP047361.1 | Macrococcus canis |
| 166 | 1555335 | 1555625 | - | NZ_CP009577.1 | Listeria ivanovii subsp. ivanovii |
| 167 | 1521243 | 1521533 | - | NC_003210.1 | Listeria monocytogenes EGD-e |
| 168 | 320709 | 321002 | + | NZ_CP065729.1 | Macrococcus caseolyticus |
| 169 | 1343498 | 1343770 | + | NZ_CP011366.1 | Salinicoccus halodurans |
| 170 | 750121 | 750420 | + | NZ_CP033433.1 | Cohnella candidum |
| 171 | 1398983 | 1399273 | + | NC_016627.1 | Acetivibrio clariflavus DSM 19732 |
| 172 | 2441825 | 2442115 | - | NZ_CP016502.1 | Acetivibrio thermocellus DSM 2360 |
| 173 | 524244 | 524537 | - | NZ_CP022096.2 | Staphylococcus pettenkoferi |
| 174 | 1444442 | 1444735 | - | NZ_LR134483.1 | Listeria grayi |
| 175 | 200582 | 200872 | + | NZ_CP014022.1 | Staphylococcus lugdunensis |
| 176 | 1798324 | 1798617 | + | NZ_CP061336.1 | Ruminiclostridium herbifermentans |
| 177 | 1080314 | 1080604 | + | NZ_CP011361.2 | Salimicrobium jeotgali |
| 178 | 2068761 | 2069051 | - | NZ_CP066042.1 | Staphylococcus saccharolyticus |
| 179 | 1892828 | 1893118 | + | NZ_CP034346.1 | Paenibacillus lutimineralis |
| 180 | 1626927 | 1627217 | + | NC_011898.1 | Ruminiclostridium cellulolyticum H10 |
| 181 | 91624 | 91893 | + | NZ_CP031092.1 | Salicibibacter kimchii |
| 182 | 1355365 | 1355673 | - | NZ_LS483306.1 | Enterococcus cecorum |
| 183 | 1954094 | 1954414 | - | NZ_CP016843.1 | Carnobacterium divergens |
| 184 | 828810 | 829121 | + | NZ_CP018061.1 | Enterococcus mundtii |
| 185 | 2571851 | 2572144 | - | NZ_CP025197.1 | Acetivibrio saccincola |
| 186 | 557377 | 557667 | + | NC_020134.1 | Thermoclostridium stercorarium subsp. stercorarium DSM 8532 |
| 187 | 187291 | 187581 | - | NZ_CP022121.1 | Dehalobacterium formicoaceticum |
| 188 | 612778 | 613095 | + | NZ_CP039712.1 | Vagococcus zengguangii |
| 189 | 1850711 | 1851022 | - | NZ_CP065211.1 | Enterococcus lactis |
| 190 | 1283666 | 1283977 | + | NC_020207.1 | Enterococcus faecium ATCC 8459 = NRRL B-2354 |
| 191 | 1230268 | 1230579 | + | NZ_AP022822.1 | Enterococcus saigonensis |
| 192 | 1426735 | 1427022 | + | NZ_AP024085.1 | Faecalibacillus intestinalis |
| 193 | 2579415 | 2579726 | - | NZ_CP023011.2 | Enterococcus hirae |
| 194 | 1529314 | 1529625 | + | NC_020995.1 | Enterococcus casseliflavus EC20 |
| 195 | 1887541 | 1887831 | + | NZ_CP014616.1 | Sporosarcina psychrophila |
| 196 | 789580 | 789870 | + | NZ_CP068564.1 | Keratinibaculum paraultunense |
| 197 | 1734527 | 1734838 | - | NZ_CP023074.1 | Enterococcus thailandicus |
| 198 | 2078735 | 2079031 | - | NC_018664.1 | Gottschalkia acidurici 9a |
| 199 | 619922 | 620212 | + | NZ_CP046996.1 | Dehalobacter restrictus |
| 200 | 2670158 | 2670451 | - | NZ_CP053187.1 | Turicibacter sanguinis |
| 201 | 3385316 | 3385606 | - | NZ_CP021850.1 | Pseudoclostridium thermosuccinogenes |
| 202 | 960766 | 961047 | + | NZ_CP012047.1 | Tetragenococcus halophilus |
| 203 | 3511126 | 3511437 | + | NZ_CP021874.1 | Enterococcus wangshanyuanii |
| 204 | 2982047 | 2982337 | - | NZ_CP036170.1 | [Clostridium] scindens ATCC 35704 |
| 205 | 1062148 | 1062438 | - | NZ_LT635479.1 | Lachnoclostridium phocaeense |
| 206 | 1814788 | 1815099 | + | NZ_CP027783.1 | Tetragenococcus osmophilus |
| 207 | 1028718 | 1029005 | - | NC_012778.1 | [Eubacterium] eligens ATCC 27750 |
| 208 | 2043165 | 2043461 | - | NZ_AP021853.1 | Sporolactobacillus terrae |
| 209 | 602204 | 602449 | - | NZ_CP027002.1 | [Ruminococcus] gnavus ATCC 29149 |
| 210 | 88509 | 88799 | + | NZ_LT990039.1 | Massilistercora timonensis |
| 211 | 1651630 | 1651920 | - | NZ_HG917868.1 | Clostridium bornimense |
| 212 | 3115924 | 3116214 | - | NC_010001.1 | Lachnoclostridium phytofermentans ISDg |
| 213 | 2310395 | 2310676 | + | NZ_CP034465.1 | Jeotgalibaca ciconiae |
| 214 | 2684024 | 2684326 | + | NZ_AP023213.1 | Citrifermentans bremense |
| 215 | 4226085 | 4226378 | - | NC_018515.1 | Desulfosporosinus meridiei DSM 13257 |
| 216 | 2193608 | 2193910 | - | NC_011146.1 | Citrifermentans bemidjiense Bem |
| 217 | 1033109 | 1033378 | + | NZ_LN879430.1 | Herbinix luporum |
| 218 | 1702634 | 1702924 | - | NZ_CP022413.2 | Blautia hansenii DSM 20583 |
| 219 | 4384744 | 4385037 | - | NC_018068.1 | Desulfosporosinus acidiphilus SJ4 |
| 220 | 2071035 | 2071292 | - | NZ_CP017194.1 | Lactococcus carnosus |
| 221 | 3080023 | 3080316 | - | NC_019903.1 | Desulfitobacterium dichloroeliminans LMG P-21439 |
| 222 | 436776 | 437087 | + | NZ_CP019728.1 | Jeotgalibaca dankookensis |
| 223 | 945382 | 945639 | - | NZ_CP023392.1 | Lactococcus raffinolactis |
| 224 | 559190 | 559486 | + | NZ_CP017253.2 | Clostridium taeniosporum |
| 225 | 633113 | 633376 | + | NZ_CP019573.1 | Abyssicoccus albus |
| 226 | 542530 | 542790 | - | NZ_CP049889.1 | Jeotgalibaca porci |
| 227 | 1787697 | 1787990 | - | NZ_LT906477.1 | Clostridium cochlearium |
| 228 | 327144 | 327389 | + | NZ_CP070062.1 | Coprococcus comes |
| 229 | 101004 | 101261 | + | NZ_CP017195.1 | Lactococcus paracarnosus |
| 230 | 3726483 | 3726776 | - | NC_018017.1 | Desulfitobacterium dehalogenans ATCC 51507 |
| 231 | 2498989 | 2499279 | - | NC_015172.1 | Syntrophobotulus glycolicus DSM 8271 |
| 232 | 546933 | 547244 | + | NZ_CP011403.1 | Ligilactobacillus salivarius str. Ren |
| 233 | 4597203 | 4597496 | - | NC_011830.1 | Desulfitobacterium hafniense DCB-2 |
| 234 | 1087162 | 1087449 | + | NZ_CP068170.1 | Erysipelatoclostridium ramosum |
| 235 | 902601 | 902861 | + | NZ_CP049886.1 | Vagococcus coleopterorum |
| 236 | 1533799 | 1534110 | - | NZ_CP017267.1 | Vagococcus teuberi |
| 237 | 349717 | 350025 | + | NZ_AP014612.1 | Streptococcus troglodytae |
| 238 | 2294778 | 2295038 | + | NZ_CP018796.1 | Lentilactobacillus parabuchneri |
| 239 | 1458159 | 1458473 | - | NZ_LS483403.1 | Streptococcus lutetiensis |
| 240 | 1171130 | 1171420 | - | NZ_CP014835.1 | Streptococcus halotolerans |
| 241 | 265730 | 266038 | + | NZ_CP010450.1 | Streptococcus pyogenes |
| 242 | 384493 | 384801 | + | NZ_LR594046.1 | Streptococcus dysgalactiae |
| 243 | 1807679 | 1807990 | + | NZ_CP049740.1 | Jeotgalibaca arthritidis |
| 244 | 1733160 | 1733471 | - | NZ_CP065993.1 | Leuconostoc pseudomesenteroides |
| 245 | 1557060 | 1557377 | - | NC_017581.1 | Streptococcus thermophilus JIM 8232 |
| 246 | 1581394 | 1581711 | - | NZ_LR134275.1 | Streptococcus vestibularis |
| 247 | 1335561 | 1335851 | + | NZ_CP030280.1 | Blautia argi |
| 248 | 2821452 | 2821712 | - | NC_016048.1 | Oscillibacter valericigenes Sjm18-20 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP033052.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13649.8 | 0.86 | 213 | 1527.0 | same-strand | Methyltransferase domain |
| 2 | PF08241.14 | 0.86 | 213 | 1527.0 | same-strand | Methyltransferase domain |
| 3 | PF13489.8 | 0.74 | 184 | 1526.5 | same-strand | Methyltransferase domain |
| 4 | PF08242.14 | 0.86 | 213 | 1527.0 | same-strand | Methyltransferase domain |
| 5 | PF02410.17 | 0.91 | 226 | 1167 | same-strand | Ribosomal silencing factor during starvation |
| 6 | PF01966.24 | 0.96 | 236 | 585 | same-strand | HD domain |
| 7 | PF01467.28 | 0.94 | 232 | 16 | same-strand | Cytidylyltransferase-like |
| 8 | PF08501.13 | 0.71 | 176 | 4 | same-strand | Shikimate dehydrogenase substrate binding domain |
| 9 | PF18317.3 | 0.7 | 172 | 4 | same-strand | Shikimate 5'-dehydrogenase C-terminal domain |
++ More..