Protein Information |
Information Type | Description |
---|---|
Protein name | Uncharacterized protein YqcB |
NCBI Accession ID | D32216.1 |
Organism | Bacillus subtilis (strain 168) |
Left | 32600 |
Right | 32872 |
Strand | + |
Nucleotide Sequence | ATGATTACACAGCTTTATAGAGAGCGTACAGCTGCAGATTTGAAAAATAGAATATCGAAAGTGCTGCTGAATGGAAATGAAACAGAAATTGTGGAACTCACCATTCAGGGTGCCGTTGTCACGGTGCTTACTCAACGAGAGGAAGACATCAAACATATTAAGAGTGTTCAGATACTTGATGATCAAAACAACGTGATTACGGAAAGAACAACAGATTTAGACGTTAGTAATAATAGAACGCTAGATTTTAGGATTACTTTTGAGGTGGTTTAA |
Sequence | MITQLYRERTAADLKNRISKVLLNGNETEIVELTIQGAVVTVLTQREEDIKHIKSVQILDDQNNVITERTTDLDVSNNRTLDFRITFEVV |
Source of smORF | Swiss-Prot |
Function | |
Pubmed ID | 7704261 8969508 9384377 7489895 |
Domain | |
Functional Category | Others |
Uniprot ID | P45937 |
ORF Length (Amino Acid) | 90 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 2668493 | 2668765 | - | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
2 | 1342955 | 1343227 | + | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
3 | 642765 | 643037 | - | NZ_CP029364.1 | Bacillus halotolerans |
4 | 1351674 | 1351946 | + | NZ_CP051464.1 | Bacillus mojavensis |
5 | 1312422 | 1312694 | + | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
6 | 1511596 | 1511868 | + | NZ_CP033052.1 | Bacillus vallismortis |
7 | 1260342 | 1260614 | + | NZ_CP048852.1 | Bacillus tequilensis |
8 | 1316308 | 1316580 | + | NZ_CP013984.1 | Bacillus inaquosorum |
9 | 2694699 | 2694971 | - | NZ_CP011937.1 | Bacillus velezensis |
10 | 1266281 | 1266553 | + | NZ_CP053376.1 | Bacillus amyloliquefaciens |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF09693.12 | 0.67 | 6 | 2015 | same-strand | Phage uncharacterised protein (Phage XkdX) |
2 | PF09636.12 | 0.67 | 6 | 2102 | same-strand | XkdW protein |
3 | PF10076.11 | 1.0 | 9 | -3.0 | same-strand | Uncharacterised protein conserved in bacteria (DUF2313) |
4 | PF04865.16 | 1.0 | 9 | 559.0 | same-strand | Baseplate J-like protein |
5 | PF10934.10 | 1.0 | 9 | 1598.0 | same-strand | Protein of unknown function (DUF2634) |
6 | PF10779.11 | 1.0 | 9 | 3524 | same-strand | Haemolysin XhlA |