Result : P44174
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein HI_1396 |
| NCBI Accession ID | L42023.1 |
| Organism | Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) |
| Left | 1493611 |
| Right | 1493781 |
| Strand | - |
| Nucleotide Sequence | ATGACTGAACGTGAGAAAATTATTCAACAACAGAAACAACTTAAAGCGTTATTTTCAGTTTGGATGAAAGAGAAAATGAATCACGAGGTGGTTATCTTTCAAAAAACTGATGGCAAGATAGTCGAGCATTATCCAGATGGTTCGGAAAAAATTGTGGGTTATGCAAAATAA |
| Sequence | MTEREKIIQQQKQLKALFSVWMKEKMNHEVVIFQKTDGKIVEHYPDGSEKIVGYAK |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 7542800 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P44174 |
| ORF Length (Amino Acid) | 56 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1518504 | 1518674 | - | NZ_LS483429.1 | Haemophilus aegyptius |
| 2 | 1411388 | 1411558 | - | NZ_CP009610.1 | Haemophilus influenzae |
| 3 | 1951659 | 1951829 | - | NC_011852.1 | Glaesserella parasuis SH0165 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LS483429.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00133.24 | 1.0 | 3 | 2177 | same-strand | tRNA synthetases class I (I, L, M and V) |
| 2 | PF08264.15 | 1.0 | 3 | 2177 | same-strand | Anticodon-binding domain of tRNA ligase |
| 3 | PF10458.11 | 1.0 | 3 | 2177 | same-strand | Valyl tRNA synthetase tRNA binding arm |
| 4 | PF04364.15 | 0.67 | 2 | 338.5 | same-strand | DNA polymerase III chi subunit, HolC |
| 5 | PF00206.22 | 0.67 | 2 | 1744.5 | opposite-strand | Lyase |
| 6 | PF10415.11 | 0.67 | 2 | 1744.5 | opposite-strand | Fumarase C C-terminus |
| 7 | PF16036.7 | 0.67 | 2 | 3266.5 | opposite-strand | Chalcone isomerase-like |
++ More..