Result : P44143
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein HI_1257 |
| NCBI Accession ID | L42023.1 |
| Organism | Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) |
| Left | 1331905 |
| Right | 1332078 |
| Strand | + |
| Nucleotide Sequence | ATGACAGAACAAGCCGCAAAACCAAAAGGCTGGTTTAAACGCGCACTTGAAAAATATGACAACTTCATTAAAGAATGGGGTTTAGATCAACCGAATTGTAGCTGCGTGCCTATGTCAGCAACAGAAGATGAAAATGGTAATTTGAAGAAAAAAGAATCTTCTTTAAAGAAATAA |
| Sequence | MTEQAAKPKGWFKRALEKYDNFIKEWGLDQPNCSCVPMSATEDENGNLKKKESSLKK |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of pfam17320. Profile Description: Family of unknown function (DUF5363). This is a family of unknown function found in Gammaproteobacteri. |
| Pubmed ID | 7542800 |
| Domain | CDD:407427 |
| Functional Category | Others |
| Uniprot ID | P44143 |
| ORF Length (Amino Acid) | 57 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1662606 | 1662779 | - | NZ_LS483429.1 | Haemophilus aegyptius |
| 2 | 1262335 | 1262508 | + | NZ_CP009610.1 | Haemophilus influenzae |
| 3 | 1712332 | 1712508 | - | NZ_LS483458.1 | Haemophilus haemolyticus |
| 4 | 2567366 | 2567539 | + | NZ_CP040863.1 | Rodentibacter heylii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LS483429.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF17848.3 | 0.75 | 3 | 5181 | same-strand | Acetyl-coA carboxylase zinc finger domain |
| 2 | PF00595.26 | 0.75 | 3 | 3595 | opposite-strand | PDZ domain |
| 3 | PF13365.8 | 0.75 | 3 | 3595 | opposite-strand | Trypsin-like peptidase domain |
| 4 | PF13180.8 | 0.75 | 3 | 3595 | opposite-strand | PDZ domain |
| 5 | PF17820.3 | 0.75 | 3 | 3595 | opposite-strand | PDZ domain |
| 6 | PF00089.28 | 0.75 | 3 | 3595 | opposite-strand | Trypsin |
| 7 | PF03461.17 | 1.0 | 4 | 76.0 | same-strand | TRCF domain |
| 8 | PF02559.18 | 1.0 | 4 | 76.0 | same-strand | CarD-like/TRCF domain |
| 9 | PF17757.3 | 1.0 | 4 | 76.0 | same-strand | UvrB interaction domain |
| 10 | PF00270.31 | 1.0 | 4 | 76.0 | same-strand | DEAD/DEAH box helicase |
| 11 | PF00271.33 | 1.0 | 4 | 76.0 | same-strand | Helicase conserved C-terminal domain |
| 12 | PF04851.17 | 1.0 | 4 | 76.0 | same-strand | Type III restriction enzyme, res subunit |
| 13 | PF05127.16 | 1.0 | 4 | -3.0 | same-strand | Helicase |
| 14 | PF00583.27 | 0.75 | 3 | -3 | same-strand | Acetyltransferase (GNAT) family |
| 15 | PF08351.13 | 0.75 | 3 | -3 | same-strand | Domain of unknown function (DUF1726) |
| 16 | PF04247.14 | 0.75 | 3 | 1972 | same-strand | Invasion gene expression up-regulator, SirB |
| 17 | PF00005.29 | 1.0 | 4 | 2374.5 | same-strand | ABC transporter |
| 18 | PF12848.9 | 0.75 | 3 | 2374 | same-strand | ABC transporter |
++ More..