Result : P41174
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Monensin polyketide synthase acyl carrier protein (ACP) |
| NCBI Accession ID | Z11511.1 |
| Organism | Streptomyces cinnamonensis |
| Left | 2678 |
| Right | 2944 |
| Strand | + |
| Nucleotide Sequence | ATGAGCGACCGACCTTTCACCCTCGCCGACCTCCAGCGCATCCTCGTCGAGGCCGCGGGCGCCGACGAGAGCGCCGGCCCCGACGACATCCTGGACACCACCTTCGCCCTGCTGGGCTACGAATCGCTCGCCCTGCTGGAGACCGGCGGCTGCATCGAGCGCGAGATCGGCATATCGCTCGACGACGACACGCTGACCGACGCCCTGACCCCCCGGGAACTGATCGACCACGTCAACGAGCGGCTGGCCGCCGCCCGCGTGGCCTGA |
| Sequence | MSDRPFTLADLQRILVEAAGADESAGPDDILDTTFALLGYESLALLETGGCIEREIGISLDDDTLTDALTPRELIDHVNERLAAARVA |
| Source of smORF | Swiss-Prot |
| Function | Acyl carrier protein. |
| Pubmed ID | 1508151 |
| Domain | CDD:415812 |
| Functional Category | Others |
| Uniprot ID | P41174 |
| ORF Length (Amino Acid) | 88 |
++ More..
| Conservation Analysis |
No. of Species: 36
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 6364140 | 6364409 | + | NZ_CP010407.1 | Streptomyces vietnamensis |
| 2 | 4209991 | 4210248 | - | NZ_CP010407.1 | Streptomyces vietnamensis |
| 3 | 2118783 | 2119052 | + | NZ_CP026652.1 | Streptomyces dengpaensis |
| 4 | 6186766 | 6187035 | + | NZ_CP029196.1 | Streptomyces venezuelae |
| 5 | 6345746 | 6346015 | + | NZ_CP023689.1 | Streptomyces chartreusis |
| 6 | 2866789 | 2867064 | - | NZ_CP029043.1 | Streptomyces nigra |
| 7 | 6648439 | 6648708 | + | NZ_CP071839.1 | Streptomyces cyanogenus |
| 8 | 4690098 | 4690373 | - | NZ_CP045643.1 | Streptomyces fagopyri |
| 9 | 4119817 | 4120125 | + | NZ_CP024957.1 | Streptomyces cavourensis |
| 10 | 7609494 | 7609751 | - | NZ_CP034539.1 | Streptomyces cyaneochromogenes |
| 11 | 4476687 | 4476959 | + | NC_021177.1 | Streptomyces fulvissimus DSM 40593 |
| 12 | 5511636 | 5511905 | + | NZ_CP054938.1 | Streptomyces harbinensis |
| 13 | 3451643 | 3451915 | - | NZ_CP063374.1 | Streptomyces chromofuscus |
| 14 | 1043395 | 1043664 | + | NZ_CP040752.1 | Streptomyces rectiverticillatus |
| 15 | 6140295 | 6140552 | + | NC_019673.1 | Saccharothrix espanaensis DSM 44229 |
| 16 | 5404744 | 5404965 | + | NZ_CP023698.1 | Streptomyces viridifaciens |
| 17 | 8237168 | 8237431 | - | NZ_CP032427.1 | Streptomyces griseorubiginosus |
| 18 | 6769357 | 6769632 | + | NZ_CP034463.1 | Streptomyces aquilus |
| 19 | 4859366 | 4859623 | - | NZ_CP022088.2 | Nocardia brasiliensis |
| 20 | 4314403 | 4314669 | + | NZ_CP071139.1 | Streptomyces nojiriensis |
| 21 | 8141504 | 8141773 | + | NZ_CP012382.1 | Streptomyces ambofaciens ATCC 23877 |
| 22 | 162168 | 162437 | - | NZ_CP012382.1 | Streptomyces ambofaciens ATCC 23877 |
| 23 | 8270005 | 8270271 | - | NZ_CP022744.1 | Streptomyces lincolnensis |
| 24 | 3806871 | 3807140 | - | NZ_CP009922.3 | Streptomyces xiamenensis |
| 25 | 7690195 | 7690440 | - | NZ_CP034550.1 | Saccharothrix syringae |
| 26 | 8831672 | 8831920 | - | NZ_CP007155.1 | Kutzneria albida DSM 43870 |
| 27 | 320530 | 320784 | + | NZ_CP011340.1 | Streptomyces pristinaespiralis |
| 28 | 8211809 | 8212063 | - | NZ_CP011340.1 | Streptomyces pristinaespiralis |
| 29 | 8198718 | 8198984 | + | NC_016582.1 | Streptomyces bingchenggensis BCW-1 |
| 30 | 4682518 | 4682766 | + | NZ_CP023202.1 | Streptomyces xinghaiensis S187 |
| 31 | 182060 | 182329 | + | NZ_CP034687.1 | Streptomyces griseoviridis |
| 32 | 1903796 | 1904026 | + | NZ_CP034687.1 | Streptomyces griseoviridis |
| 33 | 7140188 | 7140472 | + | NZ_CP072827.1 | Streptomyces mobaraensis NBRC 13819 = DSM 40847 |
| 34 | 1937117 | 1937386 | + | NZ_CP016174.1 | Amycolatopsis orientalis |
| 35 | 3961840 | 3962118 | + | NC_013131.1 | Catenulispora acidiphila DSM 44928 |
| 36 | 2366518 | 2366742 | - | NZ_CP023702.1 | Streptomyces nitrosporeus |
| 37 | 880170 | 880394 | - | NZ_CP034279.1 | Streptomyces ficellus |
| 38 | 213078 | 213341 | + | NZ_CP030864.1 | Streptomyces globosus |
| 39 | 8447883 | 8448110 | - | NZ_CP063373.1 | Streptomyces ferrugineus |
| 40 | 3259517 | 3259732 | - | NC_013510.1 | Thermomonospora curvata DSM 43183 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP010407.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04673.14 | 0.69 | 25 | 2554.5 | same-strand | Polyketide synthesis cyclase |
| 2 | PF00109.28 | 0.94 | 34 | 913.5 | same-strand | Beta-ketoacyl synthase, N-terminal domain |
| 3 | PF02801.24 | 0.94 | 34 | 913.5 | same-strand | Beta-ketoacyl synthase, C-terminal domain |
| 4 | PF00106.27 | 0.83 | 30 | 142 | same-strand | short chain dehydrogenase |
| 5 | PF13561.8 | 0.83 | 30 | 139.0 | same-strand | Enoyl-(Acyl carrier protein) reductase |
| 6 | PF10604.11 | 0.75 | 27 | 901 | same-strand | Polyketide cyclase / dehydrase and lipid transport |
| 7 | PF01494.21 | 0.69 | 25 | 2868 | same-strand | FAD binding domain |
++ More..