Result : P38583

Protein Information

• Protein name: Uncharacterized 9.1 kDa protein in BM1 immunity protein 3'region
• NCBI Accession ID: L29059.1
• Organism: Carnobacterium maltaromaticum (Carnobacterium piscicola)
• Left: 1025
• Right: 1270
• Strand: +
• Nucleotide Sequence: ATGGCTACTATTACTGATTTGTTAAACGATTTAAAAATAGACTTAGGTAACGAATCTCTACAAAATGTCTTAGAAAATTATCTTGAAGAATTGGAACAAGCAAATGCTGCTGTTCCAATTATATTAGGCCGTATGAACATAGATATCTCTACAGCAATCAGAAAAGATGGTGTTACTTTATCAGAAATTCAGTCTAAAAAATTAAAAGAGCTGATTTCAATATCCTATATTAAATATGGCTATTAA
• Sequence: MATITDLLNDLKIDLGNESLQNVLENYLEELEQANAAVPIILGRMNIDISTAIRKDGVTLSEIQSKKLKELISISYIKYGY
• Source of smORF: Swiss-Prot
• Function: The ORF matches to the profile of cl07523. Profile Description: lactococcin A immunity protein (LciA) and similar proteins. Gram-positive lactobacilli produce bacteriocins to kill closely-related competitor species. To protect themselves from the bacteriocidal activity of this molecule they co-express an immunity protein (for discussion of this operon see Bacteriocin_IIc pfam10439). The immunity protein structure is a soluble, cytoplasmic, antiparallel four alpha-helical globular bundle with a fifth, more flexible and more divergent C-terminal helical hair-pin. The C-terminal hair-pin recognizes the C-terminus of the producer bacteriocin and this interaction is sufficient to dis-orient the bacteriocin within the membrane and close up the permeabilising pore that on its own the bacteriocin creates. These immunity proteins interact in the same way with other bacteriocins, family Bacteriocin_II, pfam01721. Since many enterococci can produce more than one bacteriocin it seems likely that the whole operon can be carried on transferable plasmids.
• Pubmed ID: 8163526
• Domain: CDD:415270
• Functional Category: Others
• Uniprot ID: P38583
• ORF Length (Amino Acid): 81

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	2503647	2503874	-	NZ_CP018061.1	Enterococcus mundtii
2	2998326	2998541	+	NZ_LS991421.1	Lacticaseibacillus zeae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NZ_CP018061.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00664.25	1.0	2	2034	same-strand	ABC transporter transmembrane region
2	PF00005.29	1.0	2	2034	same-strand	ABC transporter