Result : P36937
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Potassium-transporting ATPase KdpF subunit (ATP phosphohydrolase [potassium-transporting] F chain) (Potassium-binding and translocating subunit F) (Potassium-translocating ATPase F chain) |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 728732 |
| Right | 728821 |
| Strand | - |
| Nucleotide Sequence | GTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGA |
| Sequence | MSAGVITGVLLVFLLLGYLVYALINAEAF |
| Source of smORF | Swiss-Prot |
| Function | Part of the high-affinity ATP-driven potassium transport (or Kdp) system, which catalyzes the hydrolysis of ATP coupled with the electrogenic transport of potassium into the cytoplasm (Pubmed:23930894). This subunit may be involved in stabilization of the complex (Pubmed:10608856). {ECO:0000269|Pubmed:10608856, ECO:0000269|Pubmed:23930894}. |
| Pubmed ID | 6146979 8905232 9278503 16738553 1288322 1532387 10608856 18298081 23930894 |
| Domain | CDD:173209 |
| Functional Category | Others |
| Uniprot ID | P36937 |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 78
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1358442 | 1358531 | - | NZ_LR134340.1 | Escherichia marmotae |
| 2 | 728732 | 728821 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1447068 | 1447157 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 4 | 774038 | 774127 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 5 | 4249819 | 4249908 | - | NZ_CP033744.1 | Citrobacter freundii |
| 6 | 860477 | 860566 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 7 | 1324727 | 1324816 | - | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 8 | 3173449 | 3173538 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 9 | 3249274 | 3249363 | - | NZ_CP053416.1 | Salmonella bongori |
| 10 | 2816287 | 2816376 | + | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 11 | 2721329 | 2721418 | + | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 12 | 2099294 | 2099383 | + | NZ_CP027107.1 | Cronobacter sakazakii |
| 13 | 1324847 | 1324936 | - | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 14 | 523992 | 524081 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 15 | 1338157 | 1338246 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 16 | 3003516 | 3003605 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 17 | 4240612 | 4240701 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 18 | 3298471 | 3298560 | + | NZ_LR134201.1 | Cedecea lapagei |
| 19 | 3522423 | 3522512 | + | NZ_CP023525.1 | Cedecea neteri |
| 20 | 3866505 | 3866594 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 21 | 2567533 | 2567622 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 22 | 1369134 | 1369223 | - | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 23 | 2176175 | 2176264 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 24 | 4170748 | 4170837 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 25 | 2937615 | 2937704 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 26 | 1925878 | 1925967 | + | NZ_CP038469.1 | Citrobacter tructae |
| 27 | 1440938 | 1441027 | - | NZ_CP015113.1 | Kosakonia radicincitans |
| 28 | 3767513 | 3767602 | + | NZ_CP014007.2 | Kosakonia oryzae |
| 29 | 1217136 | 1217225 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 30 | 1294207 | 1294296 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 31 | 1437817 | 1437906 | - | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 32 | 1542255 | 1542344 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 33 | 1621968 | 1622057 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 34 | 2277528 | 2277617 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 35 | 1365355 | 1365444 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 36 | 1299833 | 1299922 | - | NC_015968.1 | Enterobacter soli |
| 37 | 1345596 | 1345685 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 38 | 3467271 | 3467360 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 39 | 3258809 | 3258898 | + | NZ_CP035129.1 | Kosakonia cowanii |
| 40 | 3154825 | 3154914 | + | NZ_AP023184.1 | Buttiauxella agrestis |
| 41 | 4811231 | 4811320 | - | NC_014306.1 | Erwinia billingiae Eb661 |
| 42 | 3750843 | 3750932 | - | NC_010694.1 | Erwinia tasmaniensis Et1/99 |
| 43 | 3752621 | 3752710 | - | NC_010694.1 | Erwinia tasmaniensis Et1/99 |
| 44 | 343098 | 343187 | + | NZ_CP042941.1 | Atlantibacter hermannii |
| 45 | 252918 | 253007 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 46 | 1546956 | 1547045 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 47 | 102045 | 102134 | + | NZ_CP023567.1 | Erwinia pyrifoliae |
| 48 | 104328 | 104417 | + | NZ_CP023567.1 | Erwinia pyrifoliae |
| 49 | 1126848 | 1126937 | - | NZ_CP023009.1 | Lonsdalea britannica |
| 50 | 3665110 | 3665199 | - | NC_013961.1 | Erwinia amylovora CFBP1430 |
| 51 | 3851119 | 3851208 | - | NZ_CP065534.1 | Lonsdalea populi |
| 52 | 3441945 | 3442034 | + | NZ_LR134531.1 | Pragia fontium |
| 53 | 275068 | 275157 | + | NC_017554.1 | Pantoea ananatis PA13 |
| 54 | 775797 | 775886 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 55 | 1214078 | 1214167 | - | NZ_CP015581.1 | Tatumella citrea |
| 56 | 2297633 | 2297722 | + | NZ_FO704551.1 | Xenorhabdus poinarii G6 |
| 57 | 277174 | 277263 | + | NZ_CP038853.1 | Pantoea vagans |
| 58 | 264655 | 264744 | + | NZ_CP045720.1 | Pantoea eucalypti |
| 59 | 3800124 | 3800213 | - | NZ_CP034148.1 | Pantoea agglomerans |
| 60 | 3692072 | 3692161 | + | NZ_CP034752.1 | Jinshanibacter zhutongyuii |
| 61 | 3253474 | 3253563 | + | NZ_CP029185.2 | Limnobaculum parvum |
| 62 | 1342743 | 1342832 | - | NZ_FO704550.1 | Xenorhabdus doucetiae |
| 63 | 708557 | 708646 | - | NZ_AP014857.1 | Escherichia albertii |
| 64 | 1060838 | 1060927 | + | NC_013892.1 | Xenorhabdus bovienii SS-2004 |
| 65 | 227492 | 227581 | + | NZ_CP031264.1 | Streptacidiphilus bronchialis |
| 66 | 414875 | 414964 | + | NZ_LN907828.1 | Erwinia gerundensis |
| 67 | 4052291 | 4052380 | - | NC_016109.1 | Kitasatospora setae KM-6054 |
| 68 | 4034051 | 4034140 | + | NZ_CP050508.1 | Raoultella terrigena |
| 69 | 2587606 | 2587695 | - | NZ_CP029196.1 | Streptomyces venezuelae |
| 70 | 3896036 | 3896125 | + | NZ_CP046672.1 | Raoultella ornithinolytica |
| 71 | 3335844 | 3335933 | - | NZ_CP026047.1 | Raoultella planticola |
| 72 | 3744977 | 3745066 | + | NZ_CP041247.1 | Raoultella electrica |
| 73 | 7011102 | 7011191 | + | NZ_CP021978.1 | Streptomyces hawaiiensis |
| 74 | 4200351 | 4200443 | - | NC_012669.1 | Beutenbergia cavernae DSM 12333 |
| 75 | 2648117 | 2648206 | - | NZ_CP049115.1 | Pantoea stewartii |
| 76 | 3629224 | 3629301 | - | NZ_AP019308.1 | Paenibacillus baekrokdamisoli |
| 77 | 2862780 | 2862869 | + | NZ_CP065050.1 | Streptomyces solisilvae |
| 78 | 4202100 | 4202189 | - | NZ_CP034687.1 | Streptomyces griseoviridis |
| 79 | 1616592 | 1616681 | - | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 80 | 5676270 | 5676359 | + | NZ_CP072827.1 | Streptomyces mobaraensis NBRC 13819 = DSM 40847 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR134340.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00072.26 | 0.73 | 57 | 7019 | same-strand | Response regulator receiver domain |
| 2 | PF00486.30 | 0.73 | 57 | 7019 | same-strand | Transcriptional regulatory protein, C terminal |
| 3 | PF02702.19 | 0.91 | 71 | 4337 | same-strand | Osmosensitive K+ channel His kinase sensor domain |
| 4 | PF13493.8 | 0.9 | 70 | 4337.0 | same-strand | Domain of unknown function (DUF4118) |
| 5 | PF02518.28 | 0.88 | 69 | 4337 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 6 | PF00512.27 | 0.9 | 70 | 4337.0 | same-strand | His Kinase A (phospho-acceptor) domain |
| 7 | PF02669.17 | 1.0 | 78 | 3759.0 | same-strand | K+-transporting ATPase, c chain |
| 8 | PF00702.28 | 1.0 | 78 | 1698 | same-strand | haloacid dehalogenase-like hydrolase |
| 9 | PF00122.22 | 1.0 | 78 | 1698 | same-strand | E1-E2 ATPase |
| 10 | PF03814.17 | 1.0 | 78 | 0.0 | same-strand | Potassium-transporting ATPase A subunit |
| 11 | PF10725.11 | 0.68 | 53 | 310 | opposite-strand | Protein of unknown function (DUF2517) |
++ More..