Result : A5A627
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Small toxic protein TisB (LexA-regulated protein TisB) |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 3853553 |
| Right | 3853642 |
| Strand | + |
| Nucleotide Sequence | ATGAACCTGGTGGATATCGCCATTCTTATCCTCAAACTCATTGTTGCAGCACTGCAACTGCTTGATGCTGTTCTGAAATACCTGAAGTAA |
| Sequence | MNLVDIAILILKLIVAALQLLDAVLKYLK |
| Source of smORF | Swiss-Prot |
| Function | Toxic component of a type I toxin-antitoxin (TA) system (Pubmed:18761622) (Probable). Overexpression causes cessation of growth, induces stress-response, a number of membrane protein genes, and leads to cell death (Pubmed:15620655, Pubmed:18761622, Pubmed:18710431). Inhibits ATP synthesis, ATP levels drop drastically quickly after induction (Pubmed:18761622, Pubmed:24513967). Part of the programmed response to DNA damage; damage leads to increased accumulation of the protein which slows or stops bacterial growth, probably allowing DNA repair before cells continue to grow (Pubmed:15620655, Pubmed:18761622). {ECO:0000269|Pubmed:15620655, ECO:0000269|Pubmed:18710431, ECO:0000269|Pubmed:18761622, ECO:0000269|Pubmed:24513967, ECO:0000305|Pubmed:18710431}. |
| Pubmed ID | 9278503 16738553 10760155 15620655 17499044 18761622 18710431 24513967 |
| Domain | CDD:275252 |
| Functional Category | Toxin_type_1 |
| Uniprot ID | A5A627 |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 51
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3853553 | 3853642 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 4644153 | 4644242 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 2920657 | 2920746 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 4 | 4100519 | 4100608 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1338240 | 1338329 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 6 | 2635302 | 2635391 | + | NZ_CP033744.1 | Citrobacter freundii |
| 7 | 2444457 | 2444546 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 8 | 12857 | 12946 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 9 | 3455678 | 3455767 | - | NZ_CP038469.1 | Citrobacter tructae |
| 10 | 3998456 | 3998545 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 11 | 1815006 | 1815095 | + | NZ_CP053416.1 | Salmonella bongori |
| 12 | 424332 | 424421 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 13 | 4746315 | 4746404 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 14 | 32722 | 32811 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 15 | 3265759 | 3265848 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 16 | 30682 | 30771 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 17 | 1385284 | 1385373 | + | NZ_CP027986.1 | Enterobacter sichuanensis |
| 18 | 29141 | 29230 | - | NC_015968.1 | Enterobacter soli |
| 19 | 3540691 | 3540780 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 20 | 2420344 | 2420433 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 21 | 31077 | 31166 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 22 | 1397767 | 1397856 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 23 | 2555255 | 2555344 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 24 | 1165025 | 1165114 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 25 | 3513538 | 3513627 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 26 | 26458 | 26547 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 27 | 77134 | 77223 | - | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 28 | 3978859 | 3978948 | + | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 29 | 2668815 | 2668904 | - | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 30 | 72345 | 72434 | - | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 31 | 26088 | 26177 | - | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 32 | 4172175 | 4172264 | - | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 33 | 3361152 | 3361241 | + | NZ_CP027107.1 | Cronobacter sakazakii |
| 34 | 32832 | 32921 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 35 | 23636 | 23725 | - | NZ_CP041247.1 | Raoultella electrica |
| 36 | 31293 | 31382 | - | NZ_LR134475.1 | Klebsiella aerogenes |
| 37 | 97741 | 97830 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 38 | 82563 | 82652 | - | NZ_CP060111.1 | Klebsiella michiganensis |
| 39 | 26228 | 26317 | - | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 40 | 1753988 | 1754077 | - | NZ_CP042941.1 | Atlantibacter hermannii |
| 41 | 30487 | 30576 | - | NZ_CP046672.1 | Raoultella ornithinolytica |
| 42 | 1696430 | 1696519 | + | NZ_CP026047.1 | Raoultella planticola |
| 43 | 5290055 | 5290144 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 44 | 24022 | 24111 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 45 | 3192130 | 3192219 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 46 | 3075336 | 3075425 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 47 | 4833279 | 4833368 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 48 | 23767 | 23856 | - | NZ_CP035129.1 | Kosakonia cowanii |
| 49 | 26302 | 26391 | - | NZ_CP054254.1 | Klebsiella variicola |
| 50 | 4639817 | 4639906 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 51 | 507623 | 507712 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 52 | 5267271 | 5267360 | + | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 53 | 17895 | 17984 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 54 | 30615 | 30704 | - | NZ_AP023184.1 | Buttiauxella agrestis |
| 55 | 30306 | 30395 | - | NZ_CP050508.1 | Raoultella terrigena |
| 56 | 4298673 | 4298762 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LT556085.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07690.18 | 0.96 | 49 | 1200 | same-strand | Major Facilitator Superfamily |
| 2 | PF13710.8 | 0.78 | 40 | 2461 | opposite-strand | ACT domain |
| 3 | PF01842.27 | 0.78 | 40 | 2461 | opposite-strand | ACT domain |
| 4 | PF13291.8 | 0.76 | 39 | 2461.0 | opposite-strand | ACT domain |
| 5 | PF02776.20 | 0.84 | 43 | 769.0 | opposite-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
| 6 | PF02775.23 | 0.84 | 43 | 769.0 | opposite-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
| 7 | PF00205.24 | 0.84 | 43 | 769.0 | opposite-strand | Thiamine pyrophosphate enzyme, central domain |
| 8 | PF08049.13 | 0.63 | 32 | 574.0 | opposite-strand | IlvB leader peptide |
| 9 | PF00892.22 | 0.71 | 36 | 574 | same-strand | EamA-like transporter family |
++ More..