Protein Information |
Information Type | Description |
---|---|
Protein name | Uncharacterized protein DinQ |
NCBI Accession ID | U00096.3 |
Organism | Escherichia coli (strain K12) |
Left | 3647705 |
Right | 3647788 |
Strand | - |
Nucleotide Sequence | GTGATTGATAAAGCAATCATCGTTCTAGGGGCGTTAATTGCGCTGCTGGAACTGATCCGCTTTCTGCTTCAGCTTCTGAACTGA |
Sequence | MIDKAIIVLGALIALLELIRFLLQLLN |
Source of smORF | Swiss-Prot |
Function | |
Pubmed ID | 9278503 10760155 |
Domain | |
Functional Category | Others |
Uniprot ID | A5A624 |
ORF Length (Amino Acid) | 27 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4382142 | 4382225 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 3607132 | 3607215 | - | NZ_AP014857.1 | Escherichia albertii |
3 | 3647705 | 3647788 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
4 | 3623390 | 3623473 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
5 | 2572780 | 2572863 | - | NZ_CP057657.1 | Escherichia fergusonii |
6 | 4135117 | 4135200 | - | NZ_LR134340.1 | Escherichia marmotae |
7 | 315215 | 315298 | - | NZ_CP061527.1 | Shigella dysenteriae |
8 | 5081593 | 5081676 | - | NZ_CP015113.1 | Kosakonia radicincitans |
9 | 2419374 | 2419457 | - | NZ_CP033744.1 | Citrobacter freundii |
10 | 2678549 | 2678638 | + | NZ_CP011254.1 | Serratia fonticola |
11 | 2810648 | 2810731 | + | NZ_CP011104.1 | Photorhabdus thracensis |
12 | 4735576 | 4735659 | - | NC_005126.1 | Photorhabdus laumondii subsp. laumondii TTO1 |
13 | 4670483 | 4670566 | - | NC_005126.1 | Photorhabdus laumondii subsp. laumondii TTO1 |
14 | 3040090 | 3040173 | - | NZ_FO704550.1 | Xenorhabdus doucetiae |
15 | 37592 | 37663 | + | NC_010697.1 | Erwinia tasmaniensis Et1/99 |
16 | 4221754 | 4221837 | - | NC_012962.1 | Photorhabdus asymbiotica |
17 | 3869948 | 3870031 | + | NZ_CP060401.1 | Xenorhabdus nematophila |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF07992.16 | 0.6 | 9 | 54 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |