ProsmORF-pred
Result : P23080
Protein Information
Information Type Description
Protein name Photosystem I reaction center subunit IX
NCBI Accession ID X93923.1
Organism Trichormus variabilis (strain ATCC 29413 / PCC 7937) (Anabaena variabilis)
Left 1038
Right 1187
Strand +
Nucleotide Sequence ATGGCAGACAAAGCTGACCAATCTAGCTACCTAATTAAATTCATTTCCACAGCACCAGTTGCAGCTACTATCTGGCTGATAATCACGGCTGGGATTTTGATTGAATTCAATCGCTTTTTTCCAGATCTACTTTTCCATCCCTTACCATAA
Sequence MADKADQSSYLIKFISTAPVAATIWLIITAGILIEFNRFFPDLLFHPLP
Source of smORF Swiss-Prot
Function May help in the organization of the PsaE and PsaF subunits.
Pubmed ID 25197444 1908790
Domain CDD:420030
Functional Category Others
Uniprot ID P23080
ORF Length (Amino Acid) 49
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 16
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 3106894 3107043 - NZ_CP047242.1 Trichormus variabilis 0441
2 3411957 3412106 - NZ_CP060822.1 Cylindrospermopsis curvispora GIHE-G1
3 679685 679834 + NC_019771.1 Anabaena cylindrica PCC 7122
4 5099507 5099656 + NC_014248.1 'Nostoc azollae' 0708
5 4875708 4875857 + NC_010628.1 Nostoc punctiforme PCC 73102
6 2975515 2975664 - NZ_CP054698.1 Nostoc edaphicum CCNP1411
7 4211954 4212103 - NZ_CP024785.1 Nostoc flagelliforme CCNUN1
8 5549867 5550016 - NZ_CP031941.1 Nostoc sphaeroides
9 43585 43716 - NZ_CP018092.1 Synechococcus lividus PCC 6715
10 1141805 1141933 + NC_019729.1 Oscillatoria nigro-viridis PCC 7112
11 750425 750550 - NZ_AP018202.1 Thermostichus vulcanus NIES-2134
12 2524509 2524634 + NC_004113.1 Thermosynechococcus vestitus BP-1
13 4343975 4344103 + NC_010296.1 Microcystis aeruginosa NIES-843
14 5748913 5749044 + NC_019751.1 Calothrix sp. PCC 6303
15 1430824 1430979 - NC_009925.1 Acaryochloris marina MBIC11017
16 2028341 2028490 - NC_019695.1 Chroococcidiopsis thermalis PCC 7203
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NZ_CP047242.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF04025.14 0.62 10 1705.0 opposite-strand Domain of unknown function (DUF370)
2 PF00625.23 0.62 10 879.5 opposite-strand Guanylate kinase
3 PF02605.17 0.69 11 274 same-strand Photosystem I reaction centre subunit XI
4 PF00814.27 0.75 12 809.0 opposite-strand tRNA N6-adenosine threonylcarbamoyltransferase
++ More..