Result : P21234
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | leu operon leader peptide (leu operon attenuator peptide) |
| NCBI Accession ID | X06604.1 |
| Organism | Thermus thermophilus (strain HB8 / ATCC 27634 / DSM 579) |
| Left | 43 |
| Right | 90 |
| Strand | + |
| Nucleotide Sequence | ATGCGGCGGGCGGTGATCCTAGTCCTAGACCGGGCGGGCCCGGTCTAG |
| Sequence | MRRAVILVLDRAGPV |
| Source of smORF | Swiss-Prot |
| Function | Involved in control of the biosynthesis of leucine. |
| Pubmed ID | 3323845 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P21234 |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 822605 | 822652 | - | NZ_CP014141.1 | Thermus parvatiensis |
| 2 | 1166137 | 1166184 | + | NC_006461.1 | Thermus thermophilus HB8 |
| 3 | 1193001 | 1193048 | + | NC_019386.1 | Thermus oshimai JL-2 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_006461.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00694.21 | 1.0 | 3 | 1487 | same-strand | Aconitase C-terminal domain |
| 2 | PF05685.14 | 1.0 | 3 | 3145 | same-strand | Putative restriction endonuclease |
| 3 | PF00579.27 | 0.67 | 2 | 219.5 | opposite-strand | tRNA synthetases class I (W and Y) |
| 4 | PF00330.22 | 0.67 | 2 | 67.5 | same-strand | Aconitase family (aconitate hydratase) |
| 5 | PF00180.22 | 0.67 | 2 | 2093.5 | same-strand | Isocitrate/isopropylmalate dehydrogenase |
++ More..