ProsmORF-pred
Result : P20927
Protein Information
Information Type Description
Protein name Frd operon uncharacterized protein C
NCBI Accession ID X06151.1
Organism Proteus vulgaris
Left 900
Right 1190
Strand +
Nucleotide Sequence ATGTGCCTTGGTATTCCAGGTCAAGTTGTTGAAGTGGGAAAAACCATCACTGAAAATGCATTGGTCGATGTTTGTGGTGTTAAGCGTGAAGTGAATATCGCATTAGTTTGTGAAGGCGAGCCTGATACGATGATTGGTAAGTGGGTATTAGTGCATGTGGGTTTTGCCATGAGTATCGTTAACGAACAAGAAGCACAAGAAACCCTTAACGCATTGATGGCGATGGGGGAAGTCGAAGACGATGTGAGTGCTTTTCTCTATGGTGAGGAAAGTACAGCTAAACGTGCTTGA
Sequence MCLGIPGQVVEVGKTITENALVDVCGVKREVNIALVCEGEPDTMIGKWVLVHVGFAMSIVNEQEAQETLNALMAMGEVEDDVSAFLYGEESTAKRA
Source of smORF Swiss-Prot
Function The ORF matches to the profile of cl00394. Profile Description: HupF/HypC family. This protein is suggested by act as a chaperone for a hydrogenase large subunit, holding the precursor form before metallocenter nickel incorporation. [SS 12/31/03] More recently proposed additional function is to shuttle the iron atom that has been liganded at the HypC/HypD complex to the precursor of the large hydrogenase (HycE) subunit. . Added metallochaperone and protein mod GO terms. [Protein fate, Protein folding and stabilization, Protein fate, Protein modification and repair]
Pubmed ID 3308458
Domain CDD:412356
Functional Category Others
Uniprot ID P20927
ORF Length (Amino Acid) 96
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 115
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 3916190 3916480 + NC_010554.1 Proteus mirabilis HI4320
2 434191 434481 + NZ_CP047349.1 Proteus terrae subsp. cibarius
3 2030412 2030702 + NZ_CP026364.1 Proteus hauseri
4 1426643 1426915 - NZ_CP023536.1 Providencia alcalifaciens
5 1706187 1706483 + NZ_CP023536.1 Providencia alcalifaciens
6 784439 784735 - NZ_CP050150.1 Hafnia alvei
7 628531 628824 - NZ_CP016043.1 Edwardsiella hoshinae
8 2326714 2327007 - NZ_CP023706.1 Edwardsiella tarda
9 345510 345803 + NZ_CP029185.2 Limnobaculum parvum
10 4047750 4048043 - NZ_CP034752.1 Jinshanibacter zhutongyuii
11 1301679 1301951 - NZ_LS483422.1 Providencia heimbachae
12 3453396 3453692 - NZ_LS483422.1 Providencia heimbachae
13 4168386 4168679 + NZ_CP011254.1 Serratia fonticola
14 4259967 4260242 + NZ_CP011254.1 Serratia fonticola
15 3163455 3163748 + NC_012779.2 Edwardsiella ictaluri 93-146
16 1087887 1088180 + NZ_CP006664.1 Edwardsiella anguillarum ET080813
17 3515788 3516084 - NZ_LS483470.1 Leminorella richardii
18 1649630 1649926 + NZ_CP029736.1 Providencia rettgeri
19 2982045 2982341 - NZ_CP031123.2 Providencia huaxiensis
20 1739420 1739695 + NZ_LT906463.1 Haemophilus pittmaniae
21 1656450 1656725 + NZ_LR134327.1 Aggregatibacter aphrophilus ATCC 33389
22 3070898 3071173 - NC_012912.1 Dickeya chrysanthemi Ech1591
23 31905 32183 + NZ_CP067057.1 Rahnella aceris
24 2600237 2600533 + NZ_CP048784.1 Serratia liquefaciens
25 1040010 1040285 - NZ_CP009460.1 Dickeya fangzhongdai
26 4468555 4468842 + NZ_CP009460.1 Dickeya fangzhongdai
27 1596512 1596787 + NZ_LS483458.1 Haemophilus haemolyticus
28 1504025 1504300 + NZ_LS483443.1 Aggregatibacter segnis ATCC 33393
29 1383019 1383309 + NZ_LT615367.1 Dickeya aquatica
30 1534565 1534840 + NZ_LT615367.1 Dickeya aquatica
31 3857126 3857401 + NZ_CP015137.1 Dickeya solani IPO 2222
32 449442 449729 - NZ_CP015137.1 Dickeya solani IPO 2222
33 1567841 1568119 + NZ_CP030753.1 Actinobacillus pleuropneumoniae
34 2967149 2967439 - NC_012880.1 Musicola paradisiaca Ech703
35 1471536 1471802 + NC_012880.1 Musicola paradisiaca Ech703
36 1641103 1641378 + NZ_CP031560.1 Dickeya dianthicola
37 3241374 3241661 - NZ_CP031560.1 Dickeya dianthicola
38 3067511 3067798 - NZ_CP025799.1 Dickeya zeae
39 1727375 1727653 + NZ_CP025799.1 Dickeya zeae
40 2676715 2676990 - NZ_CP042220.2 Dickeya poaceiphila
41 1348001 1348288 + NZ_CP042220.2 Dickeya poaceiphila
42 2660201 2660494 + NZ_LR134494.1 Serratia quinivorans
43 3257736 3258023 - NC_014500.1 Dickeya dadantii 3937
44 1688887 1689162 + NC_014500.1 Dickeya dadantii 3937
45 3105374 3105643 - NZ_CP034036.1 Brenneria nigrifluens DSM 30175 = ATCC 13028
46 1852378 1852653 + NZ_CP015031.1 Basfia succiniciproducens
47 2285838 2286113 - NC_006300.1 [Mannheimia] succiniciproducens MBEL55E
48 747872 748159 + NZ_CP014137.1 Brenneria goodwinii
49 2417104 2417373 - NZ_CP014137.1 Brenneria goodwinii
50 4641343 4641636 - NC_015567.1 Serratia plymuthica AS9
51 422719 422991 - NZ_LT906448.1 Pasteurella dagmatis
52 2563665 2563952 - NZ_CP034035.1 Brenneria rubrifaciens
53 2506316 2506585 - NZ_CP034035.1 Brenneria rubrifaciens
54 1405701 1405976 + NZ_CP009610.1 Haemophilus influenzae
55 169873 170151 + NZ_CP011078.1 Yersinia ruckeri
56 3252403 3252675 - NC_013716.1 Citrobacter rodentium ICC168
57 3001090 3001362 + NC_003197.2 Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
58 4059420 4059668 - NC_009792.1 Citrobacter koseri ATCC BAA-895
59 3797479 3797751 + NC_009792.1 Citrobacter koseri ATCC BAA-895
60 2004607 2004855 + NZ_LT556085.1 Citrobacter amalonaticus
61 96598 96870 + NZ_LT556085.1 Citrobacter amalonaticus
62 821892 822164 + NZ_CP053416.1 Salmonella bongori
63 900701 900973 - NZ_CP061527.1 Shigella dysenteriae
64 3894470 3894742 - NZ_CP057657.1 Escherichia fergusonii
65 2820212 2820484 + NC_004337.2 Shigella flexneri 2a str. 301
66 2851864 2852136 + NC_000913.3 Escherichia coli str. K-12 substr. MG1655
67 3575675 3575947 + NC_002695.2 Escherichia coli O157:H7 str. Sakai
68 4075737 4076009 + NZ_CP015113.1 Kosakonia radicincitans
69 733078 733329 + NZ_CP014007.2 Kosakonia oryzae
70 1105802 1106074 - NZ_CP014007.2 Kosakonia oryzae
71 3343203 3343475 + NZ_LR134340.1 Escherichia marmotae
72 4139065 4139337 - NZ_CP045300.1 Kosakonia arachidis
73 5097013 5097261 - NZ_CP045205.1 Citrobacter telavivensis
74 1638182 1638454 - NZ_CP045205.1 Citrobacter telavivensis
75 2787729 2788001 + NZ_AP014857.1 Escherichia albertii
76 5066484 5066744 - NZ_CP023525.1 Cedecea neteri
77 107681 107959 - NC_017910.1 Shimwellia blattae DSM 4481 = NBRC 105725
78 530907 531194 + NZ_CP046293.1 Yersinia intermedia
79 1616803 1617081 + NZ_CP046293.1 Yersinia intermedia
80 1918137 1918385 - NZ_CP033744.1 Citrobacter freundii
81 1648184 1648456 + NZ_CP033744.1 Citrobacter freundii
82 3492425 3492697 - NZ_CP044098.1 Citrobacter portucalensis
83 367536 367820 - NZ_CP054043.1 Yersinia mollaretii ATCC 43969
84 2918284 2918559 + NZ_CP054043.1 Yersinia mollaretii ATCC 43969
85 4429138 4429410 - NZ_CP038469.1 Citrobacter tructae
86 3864886 3865140 + NZ_CP016337.1 Kosakonia sacchari
87 4171630 4171902 - NZ_CP016337.1 Kosakonia sacchari
88 746113 746397 + NZ_CP011118.1 Yersinia enterocolitica
89 3109293 3109571 - NZ_CP011118.1 Yersinia enterocolitica
90 2503718 2503996 - NZ_CP032487.1 Yersinia hibernica
91 4026419 4026703 - NZ_CP032487.1 Yersinia hibernica
92 5145997 5146266 + NZ_CP020388.1 Pluralibacter gergoviae
93 3927621 3927908 - NZ_CP043727.1 Yersinia canariae
94 3065625 3065903 - NZ_CP043727.1 Yersinia canariae
95 4676609 4676869 - NZ_LR134201.1 Cedecea lapagei
96 2163613 2163897 - NZ_CP009787.1 Yersinia rohdei
97 33989 34267 + NZ_CP009787.1 Yersinia rohdei
98 3849826 3850098 + NZ_CP063425.1 Kosakonia pseudosacchari
99 1484599 1484877 + NZ_CP027107.1 Cronobacter sakazakii
100 1374419 1374694 + NZ_CP026377.1 Mixta gaviniae
101 1899615 1899893 - NZ_CP012257.1 Cronobacter universalis NCTC 9529
102 162519 162779 + NZ_AP023184.1 Buttiauxella agrestis
103 2043794 2044078 - NZ_CP009781.1 Yersinia aldovae 670-83
104 4323968 4324246 + NZ_CP009781.1 Yersinia aldovae 670-83
105 2268670 2268948 + NZ_CP013940.1 Cronobacter malonaticus LMG 23826
106 1059015 1059287 - NZ_LR134475.1 Klebsiella aerogenes
107 2110215 2110493 + NZ_CP012268.1 Cronobacter muytjensii ATCC 51329
108 1037546 1037818 - NZ_CP045845.1 Kluyvera intermedia
109 597478 597750 + NZ_CP026047.1 Raoultella planticola
110 1095200 1095472 - NZ_CP046672.1 Raoultella ornithinolytica
111 1924118 1924396 - NZ_CP012266.1 Cronobacter dublinensis subsp. dublinensis LMG 23823
112 2151531 2151806 + NZ_CP012871.1 [Enterobacter] lignolyticus
113 3601209 3601481 + NZ_CP012871.1 [Enterobacter] lignolyticus
114 465630 465908 - NZ_CP042941.1 Atlantibacter hermannii
115 1213079 1213351 - NZ_CP060111.1 Klebsiella michiganensis
116 1316996 1317268 - NZ_CP036175.1 Klebsiella huaxiensis
117 4692812 4693084 - NZ_CP045769.1 Enterobacter cancerogenus
118 1012453 1012725 - NZ_CP041247.1 Raoultella electrica
119 2738287 2738565 + NZ_CP040428.1 Jejubacter calystegiae
120 1894877 1895155 - NZ_CP012264.1 Cronobacter condimenti 1330
121 1075286 1075558 - NZ_CP065838.1 Klebsiella quasipneumoniae
122 4167116 4167388 + NC_016845.1 Klebsiella pneumoniae subsp. pneumoniae HS11286
123 1082226 1082498 - NZ_CP054254.1 Klebsiella variicola
124 885391 885711 + NZ_AP020335.1 Hydrogenovibrio marinus
125 963555 963827 - NZ_CP035129.1 Kosakonia cowanii
126 4680815 4681087 - NZ_CP017279.1 Enterobacter ludwigii
127 3699010 3699282 + NC_015968.1 Enterobacter soli
128 3996118 3996390 + NZ_CP043318.1 Enterobacter chengduensis
129 1447420 1447692 + NZ_AP019007.1 Enterobacter oligotrophicus
130 3654957 3655229 + NZ_AP022508.1 Enterobacter bugandensis
131 3791145 3791417 + NZ_CP009756.1 Enterobacter cloacae
132 3698534 3698806 + NZ_CP027986.1 Enterobacter sichuanensis
133 1385252 1385530 - NZ_CP009125.1 Pectobacterium atrosepticum
134 2325100 2325384 - NZ_CP043869.1 Neptunomonas concharum
135 693911 694171 + NZ_CP047242.1 Trichormus variabilis 0441
136 2410638 2410910 + NZ_CP023529.1 Lelliottia amnigena
137 10242763 10243035 - NZ_CP035758.1 Ktedonosporobacter rubrisoli
138 4368225 4368482 + NZ_CP022684.1 Ketobacter alkanivorans
139 676251 676550 + NC_009937.1 Azorhizobium caulinodans ORS 571
140 4209080 4209361 + NZ_CP035704.1 Pseudolysobacter antarcticus
141 2210605 2210880 - NZ_CP041146.1 Nocardioides humi
142 44691 44960 + NZ_LT906483.1 Mycolicibacterium thermoresistibile
143 9772125 9772382 - NZ_CP034539.1 Streptomyces cyaneochromogenes
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NZ_CP067057.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF00158.28 0.64 74 2220.5 same-strand Sigma-54 interaction domain
2 PF14532.8 0.64 74 2220.5 same-strand Sigma-54 interaction domain
3 PF01590.28 0.63 72 2221 same-strand GAF domain
4 PF07728.16 0.64 74 2221 same-strand AAA domain (dynein-related subfamily)
5 PF13185.8 0.62 71 2221.0 same-strand GAF domain
6 PF00004.31 0.63 73 2221.0 same-strand ATPase family associated with various cellular activities (AAA)
7 PF13187.8 0.83 96 1976.0 opposite-strand 4Fe-4S dicluster domain
8 PF00037.29 0.83 96 1976.0 opposite-strand 4Fe-4S binding domain
9 PF12838.9 0.83 95 1976.0 opposite-strand 4Fe-4S dicluster domain
10 PF01155.21 0.89 102 867.0 same-strand Hydrogenase/urease nickel incorporation, metallochaperone, hypA
11 PF02492.21 0.85 98 -9.0 same-strand CobW/HypB/UreG, nucleotide-binding domain
12 PF01924.18 0.87 100 0.0 same-strand Hydrogenase formation hypA family
13 PF02769.24 0.87 100 1118 same-strand AIR synthase related protein, C-terminal domain
14 PF00586.26 0.87 100 1118 same-strand AIR synthase related protein, N-terminal domain
15 PF00361.22 0.66 76 2591.0 opposite-strand Proton-conducting membrane transporter
++ More..