Result : P13975
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Antitoxin PemI |
| NCBI Accession ID | M26840.1 |
| Organism | Escherichia coli |
| Left | 3192 |
| Right | 3449 |
| Strand | + |
| Nucleotide Sequence | ATGCATACCACCCGACTGAAGAGGGTTGGCGGCTCAGTTATGCTGACCGTCCCACCGGCACTGCTGAATGCGCTGTCTCTGGGCACAGATAATGAAGTTGGCATGGTCATTGATAATGGCCGGCTGATTGTTGAGCCGTACAGACGCCCGCAATATTCACTGGCTGAGCTACTGGCACAGTGTGATCCGAATGCTGAAATATCAGCTGAAGAACGAGAATGGCTGGATGCACCGGCGACTGGTCAGGAGGAAATCTGA |
| Sequence | MHTTRLKRVGGSVMLTVPPALLNALSLGTDNEVGMVIDNGRLIVEPYRRPQYSLAELLAQCDPNAEISAEEREWLDAPATGQEEI |
| Source of smORF | Swiss-Prot |
| Function | Antitoxin component of a type II toxin-antitoxin (TA) system. Labile antitoxin that binds to its cognate PemK endoribonuclease toxin and neutralizes its activity. Responsible for the stable maintenance of the plasmid during cell division. Both PemI and PemK proteins bind to the promoter region of the pem operon to autoregulate their synthesis. {ECO:0000269|Pubmed:2832364, ECO:0000269|Pubmed:3323833, ECO:0000269|Pubmed:8455570}. |
| Pubmed ID | 3019092 3323833 2832364 8455570 |
| Domain | CDD:412624 |
| Functional Category | Antitoxin_type_2_and_DNA-binding |
| Uniprot ID | P13975 |
| ORF Length (Amino Acid) | 85 |
++ More..
| Conservation Analysis |
No. of Species: 45
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3339 | 3596 | + | NC_013717.1 | Citrobacter rodentium ICC168 |
| 2 | 68063 | 68320 | + | NZ_CP011599.1 | Phytobacter ursingii |
| 3 | 2784255 | 2784512 | - | NC_005126.1 | Photorhabdus laumondii subsp. laumondii TTO1 |
| 4 | 2906732 | 2906989 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 5 | 434076 | 434333 | + | NZ_CP034035.1 | Brenneria rubrifaciens |
| 6 | 1394109 | 1394366 | + | NZ_LS483470.1 | Leminorella richardii |
| 7 | 3195959 | 3196216 | + | NZ_CP019706.1 | Pantoea alhagi |
| 8 | 1914848 | 1915105 | + | NZ_CP050508.1 | Raoultella terrigena |
| 9 | 1820337 | 1820594 | + | NZ_CP054254.1 | Klebsiella variicola |
| 10 | 3105797 | 3106054 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 11 | 4498488 | 4498745 | - | NZ_CP040428.1 | Jejubacter calystegiae |
| 12 | 2060553 | 2060810 | + | NZ_CP060111.1 | Klebsiella michiganensis |
| 13 | 4693220 | 4693477 | - | NZ_CP014136.1 | Gibbsiella quercinecans |
| 14 | 2839054 | 2839311 | - | NZ_CP065534.1 | Lonsdalea populi |
| 15 | 2946547 | 2946804 | - | NC_015968.1 | Enterobacter soli |
| 16 | 1884554 | 1884811 | + | NC_017554.1 | Pantoea ananatis PA13 |
| 17 | 4270845 | 4271102 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 18 | 1641675 | 1641932 | + | NZ_LR134201.1 | Cedecea lapagei |
| 19 | 2976882 | 2977139 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 20 | 1597793 | 1598050 | + | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
| 21 | 2410813 | 2411070 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 22 | 1486799 | 1487056 | + | NZ_CP038853.1 | Pantoea vagans |
| 23 | 3201612 | 3201869 | - | NC_014306.1 | Erwinia billingiae Eb661 |
| 24 | 71620 | 71877 | - | NC_020300.1 | Bartonella australis Aust/NH1 |
| 25 | 3322733 | 3322990 | - | NZ_CP049250.1 | Rhizobium rhizoryzae |
| 26 | 1453526 | 1453783 | + | NZ_CP031843.2 | Bartonella kosoyi |
| 27 | 736071 | 736328 | - | NZ_CP010401.1 | Bartonella ancashensis |
| 28 | 333007 | 333264 | - | NZ_CP026538.1 | Desulfovibrio carbinolicus |
| 29 | 910458 | 910715 | + | NZ_CP031844.2 | Bartonella krasnovii |
| 30 | 1813303 | 1813560 | + | NZ_LR134529.1 | Bartonella vinsonii |
| 31 | 1974429 | 1974686 | + | NZ_LR134529.1 | Bartonella vinsonii |
| 32 | 489416 | 489673 | + | NC_010161.1 | Bartonella tribocorum CIP 105476 |
| 33 | 77119 | 77376 | + | NZ_CP020539.1 | Sphingobium herbicidovorans |
| 34 | 423659 | 423916 | + | NZ_LR134527.1 | Bartonella elizabethae |
| 35 | 911587 | 911844 | + | NZ_AP018795.1 | Acidithiobacillus ferridurans |
| 36 | 3014039 | 3014296 | - | NC_017059.1 | Pararhodospirillum photometricum DSM 122 |
| 37 | 812021 | 812278 | + | NZ_HG965802.1 | Bartonella henselae |
| 38 | 1542687 | 1542944 | - | NC_015942.1 | Acidithiobacillus ferrivorans SS3 |
| 39 | 832855 | 833112 | - | NZ_AP022615.1 | Mycobacterium heidelbergense |
| 40 | 1577589 | 1577846 | - | NZ_CP030840.1 | Acidisarcina polymorpha |
| 41 | 9583 | 9840 | + | NZ_AP021883.1 | Sulfuriferula nivalis |
| 42 | 213441 | 213698 | + | NZ_CP063849.1 | Paludibaculum fermentans |
| 43 | 2727735 | 2727992 | - | NZ_CP063849.1 | Paludibaculum fermentans |
| 44 | 669344 | 669601 | - | NZ_CP049241.1 | Rhizobium pseudoryzae |
| 45 | 4783766 | 4784017 | + | NC_008345.1 | Shewanella frigidimarina NCIMB 400 |
| 46 | 2000800 | 2001057 | + | NZ_CP019082.1 | Paludisphaera borealis |
| 47 | 5023003 | 5023215 | - | NZ_CP045300.1 | Kosakonia arachidis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_013717.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02452.19 | 0.87 | 39 | 1.0 | same-strand | PemK-like, MazF-like toxin of type II toxin-antitoxin system |
++ More..