Result : P13959
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Replication regulatory protein RepA2 (Protein CopB) |
| NCBI Accession ID | M16167.1 |
| Organism | Escherichia coli (strain K12) |
| Left | 192 |
| Right | 449 |
| Strand | + |
| Nucleotide Sequence | ATGTCGCAGACAGAAAATGCAGTGACTTCCTCATCAGGTAACAAGCGTGCATACCGGAAAGGTAACCCTGTTCCGGCCAGAGAGAGACAAAGGGCTTCTCTAGCTCGCAGAAGCAACACTCATAAGGCTTTTCATGCGGTTATCCAGGCCCGGTTAAAAGACAGGCTGAGTGAACTGGCAGATGAGGAAGGTATTACCCAGGCGCAGATGCTTGAAAAACTGATTGAATCAGAGCTGAAACGTAGAGCGACTTTGTAA |
| Sequence | MSQTENAVTSSSGNKRAYRKGNPVPARERQRASLARRSNTHKAFHAVIQARLKDRLSELADEEGITQAQMLEKLIESELKRRATL |
| Source of smORF | Swiss-Prot |
| Function | This protein is involved in the determination of copy number in gene replication. It binds to the repA promoter thus inhibiting the synthesis of the mRNA for the initiator protein RepA. |
| Pubmed ID | 3032897 |
| Domain | CDD:332665 |
| Functional Category | DNA-binding |
| Uniprot ID | P13959 |
| ORF Length (Amino Acid) | 85 |
++ More..
| Conservation Analysis |
No. of Species: 8
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 38001 | 38261 | - | NZ_CP054255.1 | Klebsiella variicola |
| 2 | 100013 | 100261 | - | NZ_CP036176.1 | Klebsiella huaxiensis |
| 3 | 72385 | 72645 | + | NZ_CP041249.1 | Raoultella electrica |
| 4 | 56830 | 57090 | - | NZ_CP032488.1 | Yersinia hibernica |
| 5 | 1355 | 1600 | + | NC_003277.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 6 | 71999 | 72253 | + | NC_002128.1 | Escherichia coli O157:H7 str. Sakai |
| 7 | 240 | 494 | + | NC_013717.1 | Citrobacter rodentium ICC168 |
| 8 | 73016 | 73285 | - | NZ_CP026048.1 | Raoultella planticola |
| 9 | 159484 | 159753 | - | NZ_CP026049.1 | Raoultella planticola |
++ More..