Protein Information |
Information Type | Description |
---|---|
Protein name | Phycobilisome 9.7 kDa linker polypeptide, phycocyanin-associated, rod (L-9.7/R) (Rod-capping linker protein) |
NCBI Accession ID | M16490.1 |
Organism | Microchaete diplosiphon (Fremyella diplosiphon) |
Left | 1860 |
Right | 2117 |
Strand | + |
Nucleotide Sequence | ATGTTAGGTTCTGTATTGACCAGAAGATCTAGTTCCGGTTCAGACAATCGCGTCTTTGTTTACGAAGTAGAAGGATTGCGCCAGAACGAGCAAACTGATAACAATCGTTATCAGATTCGCAATAGCAGCACGATTGAGATTCAAGTCCCTTACAGCCGGATGAATGAAGAAGATCGTCGCATCACCCGCTTAGGCGGCAGAATTGTTAACATCCGTCCTGCAGGTGAAAATCCAACTGAAGATGCATCAGAAAACTGA |
Sequence | MLGSVLTRRSSSGSDNRVFVYEVEGLRQNEQTDNNRYQIRNSSTIEIQVPYSRMNEEDRRITRLGGRIVNIRPAGENPTEDASEN |
Source of smORF | Swiss-Prot |
Function | Rod linker protein, associated with phycocyanin. Linker polypeptides determine the state of aggregation and the location of the disk-shaped phycobiliprotein units within the phycobilisome and modulate their spectroscopic properties in order to mediate a directed and optimal energy transfer. |
Pubmed ID | 3108238 |
Domain | CDD:413625 |
Functional Category | Others |
Uniprot ID | P11397 |
ORF Length (Amino Acid) | 85 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3368107 | 3368364 | + | NC_019748.1 | Stanieria cyanosphaera PCC 7437 |
2 | 176323 | 176562 | - | NC_011729.1 | Gloeothece citriformis PCC 7424 |
3 | 1112104 | 1112328 | + | NC_010296.1 | Microcystis aeruginosa NIES-843 |
4 | 1805813 | 1806055 | - | NC_014501.1 | Gloeothece verrucosa PCC 7822 |
5 | 2544943 | 2545203 | - | NC_019776.1 | Cyanobacterium aponinum PCC 10605 |
6 | 6546715 | 6546972 | + | NC_010628.1 | Nostoc punctiforme PCC 73102 |
7 | 1516829 | 1517083 | + | NC_019693.1 | Oscillatoria acuminata PCC 6304 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00502.21 | 0.86 | 6 | 2066 | same-strand | Phycobilisome protein |
2 | PF00427.23 | 0.86 | 6 | 224.5 | same-strand | Phycobilisome Linker polypeptide |
3 | PF01383.23 | 1.0 | 7 | 289 | same-strand | CpcD/allophycocyanin linker domain |