Result : P11221
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Major outer membrane lipoprotein (Outer membrane lipoprotein I) |
| NCBI Accession ID | X13748.1 |
| Organism | Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) |
| Left | 209 |
| Right | 460 |
| Strand | + |
| Nucleotide Sequence | ATGAACAACGTTCTGAAATTCTCTGCTCTGGCTCTGGCTGCTGTTCTGGCCACCGGTTGCAGCAGCCACTCCAAAGAAACCGAAGCTCGTCTGACCGCTACCGAAGACGCAGCTGCTCGTGCTCAGGCTCGCGCTGACGAAGCCTATCGCAAGGCTGACGAAGCTCTGGGCGCTGCTCAGAAAGCTCAGCAGACCGCTGACGAGGCTAACGAGCGTGCCCTGCGCATGCTGGAAAAAGCCAGCCGCAAGTAA |
| Sequence | MNNVLKFSALALAAVLATGCSSHSKETEARLTATEDAAARAQARADEAYRKADEALGAAQKAQQTADEANERALRMLEKASRK |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 2473376 2502533 1588307 10984043 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P11221 |
| ORF Length (Amino Acid) | 83 |
++ More..
| Conservation Analysis |
No. of Species: 55
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3206915 | 3207166 | + | NC_002516.2 | Pseudomonas aeruginosa PAO1 |
| 2 | 4306006 | 4306257 | + | NZ_CP048833.1 | Pseudomonas multiresinivorans |
| 3 | 2196017 | 2196268 | - | NZ_CP014158.1 | Pseudomonas citronellolis |
| 4 | 2403392 | 2403643 | - | NZ_CP013124.1 | Pseudomonas mendocina S5.2 |
| 5 | 4919619 | 4919870 | + | NZ_CP070505.1 | Pseudomonas toyotomiensis |
| 6 | 3797353 | 3797604 | + | NZ_CP047698.1 | Pseudomonas knackmussii |
| 7 | 2268004 | 2268255 | + | NZ_CP048810.1 | Pseudomonas bijieensis |
| 8 | 4917171 | 4917422 | + | NZ_LS999205.1 | Pseudomonas protegens CHA0 |
| 9 | 3573439 | 3573690 | + | NZ_CP043311.1 | Pseudomonas lalkuanensis |
| 10 | 1966233 | 1966484 | - | NZ_AP022642.1 | Pseudomonas otitidis |
| 11 | 3363460 | 3363711 | + | NZ_AP014862.1 | Pseudomonas furukawaii |
| 12 | 110489 | 110740 | + | NZ_CP014205.2 | Pseudomonas glycinae |
| 13 | 4840795 | 4841046 | + | NZ_CP061079.1 | Pseudomonas chlororaphis |
| 14 | 3343882 | 3344124 | + | NZ_CP061079.1 | Pseudomonas chlororaphis |
| 15 | 2641566 | 2641817 | - | NZ_CP060009.1 | Pseudomonas sediminis |
| 16 | 2921165 | 2921416 | + | NZ_CP068551.1 | Pseudomonas khazarica |
| 17 | 2376989 | 2377240 | - | NZ_CP049044.1 | Pseudomonas psychrophila |
| 18 | 1651371 | 1651622 | - | NZ_CP062158.2 | Pseudomonas lundensis |
| 19 | 914347 | 914598 | - | NZ_CP012676.1 | Pseudomonas versuta |
| 20 | 2065027 | 2065278 | - | NZ_CP054205.1 | Pseudomonas rhodesiae |
| 21 | 1780705 | 1780956 | - | NZ_CP027723.1 | Pseudomonas orientalis |
| 22 | 1814727 | 1814978 | - | NZ_CP023272.1 | Pseudomonas lurida |
| 23 | 1862365 | 1862616 | - | NZ_CP010896.1 | Pseudomonas simiae |
| 24 | 2018077 | 2018328 | - | NZ_CP027756.1 | Pseudomonas synxantha |
| 25 | 1917789 | 1918040 | - | NZ_CP018420.1 | Pseudomonas veronii |
| 26 | 3370061 | 3370315 | + | NZ_CP018420.1 | Pseudomonas veronii |
| 27 | 4548520 | 4548771 | + | NZ_CP012400.2 | Pseudomonas yamanorum |
| 28 | 1921527 | 1921778 | - | NZ_CP070503.1 | Pseudomonas atacamensis |
| 29 | 4429625 | 4429876 | + | NZ_CP029608.1 | Pseudomonas kribbensis |
| 30 | 4642057 | 4642308 | + | NZ_CP062253.1 | Pseudomonas gozinkensis |
| 31 | 4683675 | 4683926 | + | NZ_CP062252.1 | Pseudomonas allokribbensis |
| 32 | 1675460 | 1675711 | - | NZ_CP014870.1 | Pseudomonas silesiensis |
| 33 | 2775093 | 2775308 | + | NZ_CP014870.1 | Pseudomonas silesiensis |
| 34 | 4750902 | 4751153 | + | NZ_CP051487.1 | Pseudomonas umsongensis |
| 35 | 5485261 | 5485512 | - | NZ_CP014262.1 | Pseudomonas corrugata |
| 36 | 399107 | 399358 | - | NZ_CP009533.1 | Pseudomonas rhizosphaerae |
| 37 | 3711950 | 3712201 | + | NZ_CP068034.2 | Pseudomonas syringae |
| 38 | 1771721 | 1771972 | + | NZ_CP005960.1 | Pseudomonas mandelii JR-1 |
| 39 | 1894437 | 1894688 | - | NZ_CP035088.1 | Pseudomonas viciae |
| 40 | 3904200 | 3904427 | - | NZ_CP035088.1 | Pseudomonas viciae |
| 41 | 1928314 | 1928565 | - | NZ_CP034725.1 | Pseudomonas brassicacearum |
| 42 | 3597908 | 3598159 | + | NZ_CP007039.1 | Pseudomonas cichorii JBC1 |
| 43 | 3670207 | 3670458 | + | NZ_CP067022.1 | Pseudomonas cannabina pv. alisalensis |
| 44 | 2341608 | 2341859 | - | NZ_CP042804.1 | Pseudomonas amygdali pv. tabaci str. ATCC 11528 |
| 45 | 2514998 | 2515249 | - | NC_004578.1 | Pseudomonas syringae pv. tomato str. DC3000 |
| 46 | 1908143 | 1908394 | - | NZ_CP056030.1 | Pseudomonas eucalypticola |
| 47 | 2812515 | 2812766 | + | NZ_LR215729.2 | Pseudomonas marincola |
| 48 | 1903589 | 1903840 | - | NZ_CP011835.1 | Azotobacter chroococcum |
| 49 | 3889946 | 3890197 | + | NZ_CP071706.1 | Pseudomonas donghuensis |
| 50 | 2904768 | 2905019 | + | NZ_CP009365.1 | Pseudomonas soli |
| 51 | 3623354 | 3623605 | + | NZ_CP024159.1 | Pseudomonas mosselii |
| 52 | 3981327 | 3981578 | + | NC_021505.1 | Pseudomonas putida NBRC 14164 |
| 53 | 1978860 | 1979111 | - | NC_008027.1 | Pseudomonas entomophila L48 |
| 54 | 1455180 | 1455431 | + | NZ_CP031146.1 | Pseudomonas plecoglossicida |
| 55 | 2131077 | 2131328 | - | NZ_CP022562.1 | Pseudomonas monteilii |
| 56 | 1965381 | 1965632 | - | NZ_CP046621.1 | Pseudomonas alkylphenolica |
| 57 | 2306319 | 2306570 | - | NC_012560.1 | Azotobacter vinelandii DJ |
| 58 | 4739787 | 4740041 | - | NZ_CP045302.1 | Azotobacter salinestris |
| 59 | 2716849 | 2717091 | - | NZ_CP029822.1 | Entomomonas moraniae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP013124.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03734.16 | 0.98 | 54 | 129.0 | opposite-strand | L,D-transpeptidase catalytic domain |
| 2 | PF13472.8 | 0.96 | 53 | 1564 | opposite-strand | GDSL-like Lipase/Acylhydrolase family |
| 3 | PF00657.24 | 0.96 | 53 | 1564 | opposite-strand | GDSL-like Lipase/Acylhydrolase |
| 4 | PF00005.29 | 0.96 | 53 | 2181.5 | same-strand | ABC transporter |
| 5 | PF14542.8 | 0.91 | 50 | 614.5 | opposite-strand | GCN5-related N-acetyl-transferase |
| 6 | PF00793.22 | 0.89 | 49 | 984 | same-strand | DAHP synthetase I family |
| 7 | PF02558.18 | 0.64 | 35 | 2981 | opposite-strand | Ketopantoate reductase PanE/ApbA |
| 8 | PF08546.13 | 0.64 | 35 | 2981 | opposite-strand | Ketopantoate reductase PanE/ApbA C terminal |
++ More..