Result : P0DPP8

Protein Information

• Protein name: Protein YsdD
• NCBI Accession ID: U00096.3
• Organism: Escherichia coli (strain K12)
• Left: 3884026
• Right: 3884106
• Strand: +
• Nucleotide Sequence: ATGACCATAGACAAAAATTGGCTTAATCGATCTAATAAAGATCCAGGACGATCCTTGCGCTTTACCCATCAGCCCGTATAA
• Sequence: MTIDKNWLNRSNKDPGRSLRFTHQPV
• Source of smORF: Swiss-Prot
• Pubmed ID: 9278503 29645342
• Functional Category: Others
• Uniprot ID: P0DPP8
• ORF Length (Amino Acid): 26

Conservation Analysis

No. of Species: 19

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	4670384	4670464	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	3884026	3884106	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	3868652	3868732	-	NC_004337.2	Shigella flexneri 2a str. 301
4	4072754	4072834	-	NZ_CP061527.1	Shigella dysenteriae
5	3858624	3858704	+	NZ_AP014857.1	Escherichia albertii
6	2889843	2889923	-	NZ_CP057657.1	Escherichia fergusonii
7	2665991	2666071	+	NZ_CP033744.1	Citrobacter freundii
8	2418963	2419043	-	NZ_CP044098.1	Citrobacter portucalensis
9	3428502	3428582	-	NZ_CP038469.1	Citrobacter tructae
10	49373	49453	-	NZ_CP012264.1	Cronobacter condimenti 1330
11	1366290	1366370	+	NZ_LT556085.1	Citrobacter amalonaticus
12	4616265	4616345	+	NZ_CP012871.1	[Enterobacter] lignolyticus
13	6183206	6183286	-	NZ_CP036175.1	Klebsiella huaxiensis
14	4002190	4002270	+	NZ_CP012268.1	Cronobacter muytjensii ATCC 51329
15	51011	51091	-	NZ_CP012266.1	Cronobacter dublinensis subsp. dublinensis LMG 23823
16	455868	455948	+	NZ_CP045205.1	Citrobacter telavivensis
17	48177	48257	+	NC_009792.1	Citrobacter koseri ATCC BAA-895
18	1733720	1733800	-	NZ_CP042941.1	Atlantibacter hermannii
19	5314454	5314534	+	NZ_CP015113.1	Kosakonia radicincitans
20	5415785	5415865	-	NZ_CP014007.2	Kosakonia oryzae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_002695.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00204.27	0.89	17	3989.0	opposite-strand	DNA gyrase B
2	PF18053.3	0.89	17	3989.0	opposite-strand	DNA gyrase B subunit insert domain
3	PF00986.23	0.89	17	3989.0	opposite-strand	DNA gyrase B subunit, carboxyl terminus
4	PF02518.28	0.89	17	3989.0	opposite-strand	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
5	PF01751.24	0.89	17	3989.0	opposite-strand	Toprim domain
6	PF02463.21	0.89	17	2887.0	opposite-strand	RecF/RecN/SMC N terminal domain
7	PF02767.18	0.89	17	1705.0	opposite-strand	DNA polymerase III beta subunit, central domain
8	PF00712.21	0.89	17	1705.0	opposite-strand	DNA polymerase III beta subunit, N-terminal domain
9	PF02768.17	0.89	17	1705.0	opposite-strand	DNA polymerase III beta subunit, C-terminal domain
10	PF00308.20	0.89	17	298.0	opposite-strand	Bacterial dnaA protein
11	PF08299.13	0.84	16	298	opposite-strand	Bacterial dnaA protein helix-turn-helix
12	PF11638.10	0.89	17	298.0	opposite-strand	DnaA N-terminal domain
13	PF00004.31	0.84	16	298	opposite-strand	ATPase family associated with various cellular activities (AAA)
14	PF00825.20	0.95	18	420	same-strand	Ribonuclease P
15	PF14849.8	1.0	19	970.0	same-strand	YidC periplasmic domain
16	PF02096.22	1.0	19	970.0	same-strand	60Kd inner membrane protein
17	PF12631.9	1.0	19	2722.0	same-strand	MnmE helical domain
18	PF10396.11	1.0	19	2722.0	same-strand	GTP-binding protein TrmE N-terminus
19	PF01926.25	0.79	15	2722.0	same-strand	50S ribosome-binding GTPase