Result : P0DPP7
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Protein YqiD |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 3183381 |
| Right | 3183551 |
| Strand | - |
| Nucleotide Sequence | ATGTTTATCGCCTGGTACTGGATTGTATTGATTGCTCTGGTTGTGGTGGGTTATTTCCTGCATTTGAAACGTTATTGTCGGGCGTTTCGCCAGGACAGAGACGCACTGCTTGAAGCGCGGAACAAATACTTAAACAGTACGAGAGAAGAGACAGCCGAAAAGGTAGAATAA |
| Sequence | MFIAWYWIVLIALVVVGYFLHLKRYCRAFRQDRDALLEARNKYLNSTREETAEKVE |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of pfam13260. Profile Description: Protein of unknown function (DUF4051). This family of proteins is functionally uncharacterized. This family of proteins is found in bacteria. Proteins in this family are approximately 60 amino acids in length. |
| Pubmed ID | 9278503 29645342 |
| Domain | CDD:372537 |
| Functional Category | Others |
| Uniprot ID | P0DPP7 |
| ORF Length (Amino Acid) | 56 |
++ More..
| Conservation Analysis |
No. of Species: 15
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3176516 | 3176686 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 2 | 3183381 | 3183551 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3709808 | 3709978 | - | NZ_LR134340.1 | Escherichia marmotae |
| 4 | 3929603 | 3929773 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 5 | 644739 | 644906 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 3175599 | 3175769 | - | NZ_AP014857.1 | Escherichia albertii |
| 7 | 4131433 | 4131609 | + | NZ_CP038469.1 | Citrobacter tructae |
| 8 | 3127117 | 3127293 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 9 | 1968992 | 1969168 | - | NZ_CP033744.1 | Citrobacter freundii |
| 10 | 2079069 | 2079236 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 11 | 3353933 | 3354109 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 12 | 4105571 | 4105747 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 13 | 3778098 | 3778274 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 14 | 1206874 | 1207050 | - | NZ_CP053416.1 | Salmonella bongori |
| 15 | 5145881 | 5146057 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 16 | 1962855 | 1963031 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP038469.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02321.20 | 0.73 | 11 | 3806.5 | opposite-strand | Outer membrane efflux protein |
| 2 | PF06693.13 | 0.73 | 11 | 2970.5 | opposite-strand | Protein of unknown function (DUF1190) |
| 3 | PF03738.16 | 0.73 | 11 | 1804.5 | opposite-strand | Glutathionylspermidine synthase preATP-grasp |
| 4 | PF02900.20 | 0.93 | 14 | 947 | same-strand | Catalytic LigB subunit of aromatic ring-opening dioxygenase |
| 5 | PF00926.21 | 0.87 | 13 | 1973.0 | same-strand | 3,4-dihydroxy-2-butanone 4-phosphate synthase |
| 6 | PF04380.15 | 0.67 | 10 | 1291 | opposite-strand | Membrane fusogenic activity |
| 7 | PF17425.4 | 0.6 | 9 | 400 | opposite-strand | Arylsulfotransferase Ig-like domain |
| 8 | PF01323.22 | 0.6 | 9 | 2218 | opposite-strand | DSBA-like thioredoxin domain |
| 9 | PF13462.8 | 0.6 | 9 | 2218 | opposite-strand | Thioredoxin |
| 10 | PF02600.18 | 0.6 | 9 | 2899 | opposite-strand | Disulfide bond formation protein DsbB |
++ More..