Result : P0DPP5
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Protein YqfI |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 3050958 |
| Right | 3051041 |
| Strand | + |
| Nucleotide Sequence | ATGTCAAAAAACACTAAATCAAAAAATAATGGCATTAGAAAATATAATGCGAAAACGGAGGTGAAATTAGTTTATTTCAAATGA |
| Sequence | MSKNTKSKNNGIRKYNAKTEVKLVYFK |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 9278503 29645342 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P0DPP5 |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 9
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3050958 | 3051041 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 2984871 | 2984954 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 665683 | 665766 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 1944903 | 1944986 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 5 | 3788213 | 3788296 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 6 | 3527610 | 3527693 | + | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 2987627 | 2987710 | + | NZ_AP014857.1 | Escherichia albertii |
| 8 | 358257 | 358340 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 9 | 5188987 | 5189070 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 10 | 3959724 | 3959807 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00232.20 | 0.89 | 8 | 5734 | same-strand | Glycosyl hydrolase family 1 |
| 2 | PF02347.18 | 1.0 | 9 | 1917.0 | opposite-strand | Glycine cleavage system P-protein |
| 3 | PF01597.21 | 1.0 | 9 | 1409.0 | opposite-strand | Glycine cleavage H-protein |
| 4 | PF01571.23 | 1.0 | 9 | 291.0 | opposite-strand | Aminomethyltransferase folate-binding domain |
| 5 | PF08669.13 | 1.0 | 9 | 291.0 | opposite-strand | Glycine cleavage T-protein C-terminal barrel domain |
| 6 | PF01494.21 | 1.0 | 9 | 688.0 | opposite-strand | FAD binding domain |
| 7 | PF00557.26 | 1.0 | 9 | 2474.0 | opposite-strand | Metallopeptidase family M24 |
| 8 | PF05195.18 | 1.0 | 9 | 2474.0 | opposite-strand | Aminopeptidase P, N-terminal domain |
| 9 | PF03695.15 | 1.0 | 9 | 3825.0 | opposite-strand | Uncharacterised protein family (UPF0149) |
| 10 | PF05164.15 | 1.0 | 9 | 4571.0 | same-strand | Cell division protein ZapA |
++ More..