ProsmORF-pred
Result : P0DPP4
Protein Information
Information Type Description
Protein name Protein YqfH
NCBI Accession ID U00096.3
Organism Escherichia coli (strain K12)
Left 3032939
Right 3033010
Strand -
Nucleotide Sequence ATGATTAACCAAGTGAGCGTTTATCGACAACCGCCCGTTTTGAGCGGATGCCGACAGGTAAAAACCATTTAA
Sequence MINQVSVYRQPPVLSGCRQVKTI
Source of smORF Swiss-Prot
Function
Pubmed ID 9278503 29645342
Domain
Functional Category Others
Uniprot ID P0DPP4
ORF Length (Amino Acid) 23
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 3
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 3771216 3771287 - NC_002695.2 Escherichia coli O157:H7 str. Sakai
2 3032939 3033010 - NC_000913.3 Escherichia coli str. K-12 substr. MG1655
3 647016 647087 - NZ_CP061527.1 Shigella dysenteriae
4 2966854 2966925 - NC_004337.2 Shigella flexneri 2a str. 301
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NC_004337.2
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF00860.22 0.67 2 124 opposite-strand Permease family
2 PF00293.30 1.0 3 55.0 opposite-strand NUDIX domain
3 PF00152.22 1.0 3 646.0 same-strand tRNA synthetases class II (D, K and N)
4 PF01336.27 1.0 3 646.0 same-strand OB-fold nucleic acid binding domain
5 PF00472.22 1.0 3 2173.0 same-strand RF-1 domain
6 PF02272.21 1.0 3 3362.0 same-strand DHHA1 domain
7 PF01368.22 1.0 3 3362.0 same-strand DHH family
8 PF17768.3 1.0 3 3362.0 same-strand RecJ OB domain
9 PF13098.8 1.0 3 5101.0 same-strand Thioredoxin-like domain
10 PF10411.11 1.0 3 5101.0 same-strand Disulfide bond isomerase protein N-terminus
11 PF00665.28 0.67 2 1825.0 same-strand Integrase core domain
12 PF13683.8 0.67 2 1825.0 same-strand Integrase core domain
13 PF01527.22 0.67 2 1494.5 same-strand Transposase
++ More..