Protein Information |
Information Type | Description |
---|---|
Protein name | Protein YnfS |
NCBI Accession ID | U00096.3 |
Organism | Escherichia coli (strain K12) |
Left | 1642122 |
Right | 1642211 |
Strand | + |
Nucleotide Sequence | ATGAATAACCCCGTCTGTCTTGATGACTGGTTGATTGGCTTTAAAAGCTTATGCTGTACTTTGGCCGTAATAGCTCTGCTAATAATATAA |
Sequence | MNNPVCLDDWLIGFKSLCCTLAVIALLII |
Source of smORF | Swiss-Prot |
Function | |
Pubmed ID | 9278503 29645342 |
Domain | |
Functional Category | Others |
Uniprot ID | P0DPP0 |
ORF Length (Amino Acid) | 29 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1642122 | 1642211 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 610269 | 610358 | + | NZ_CP033744.1 | Citrobacter freundii |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00313.24 | 1.0 | 2 | 568 | opposite-strand | 'Cold-shock' DNA-binding domain |