Result : P0DPO6
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Protein YddY |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 1567178 |
| Right | 1567219 |
| Strand | - |
| Nucleotide Sequence | ATGGTGCAGTTAGTCGATCTCGCACGTTGCGTTTCATTTTGA |
| Sequence | MVQLVDLARCVSF |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 9278503 29645342 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P0DPO6 |
| ORF Length (Amino Acid) | 13 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1567178 | 1567219 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 1775101 | 1775142 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 2130815 | 2130856 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF11563.10 | 0.67 | 2 | 38.0 | same-strand | Protoglobin |
| 2 | PF02638.17 | 1.0 | 3 | 285 | same-strand | Glycosyl hydrolase-like 10 |
| 3 | PF13520.8 | 1.0 | 3 | 1735 | same-strand | Amino acid permease |
| 4 | PF00324.23 | 1.0 | 3 | 1735 | same-strand | Amino acid permease |
| 5 | PF00282.21 | 1.0 | 3 | 3426 | same-strand | Pyridoxal-dependent decarboxylase conserved domain |
| 6 | PF05193.23 | 0.67 | 2 | 5618.0 | same-strand | Peptidase M16 inactive domain |
| 7 | PF00675.22 | 0.67 | 2 | 5618.0 | same-strand | Insulinase (Peptidase family M16) |
++ More..