Result : P0DPN4
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Protein YldA |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 643330 |
| Right | 643419 |
| Strand | - |
| Nucleotide Sequence | ATGGCAGAAGCATTTTACATCCTGATAGGATTTCTGATTATGGCGGCGATTATCGTCATGGCTGTCCTTTACCTCGAAAACCACTCCTGA |
| Sequence | MAEAFYILIGFLIMAAIIVMAVLYLENHS |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 9278503 29645342 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P0DPN4 |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 15
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 724685 | 724774 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 643330 | 643419 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 549177 | 549266 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 4253661 | 4253750 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 5 | 2855535 | 2855624 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 6 | 2353376 | 2353465 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 7 | 686112 | 686201 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 8 | 1476280 | 1476369 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 9 | 3787891 | 3787980 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 10 | 1219951 | 1220040 | - | NC_015968.1 | Enterobacter soli |
| 11 | 1228208 | 1228297 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 12 | 1282421 | 1282510 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 13 | 1273307 | 1273396 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 14 | 1283345 | 1283434 | - | NZ_LR134340.1 | Escherichia marmotae |
| 15 | 2249529 | 2249618 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 16 | 1531490 | 1531579 | + | NZ_CP057657.1 | Escherichia fergusonii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LT556085.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00578.23 | 0.6 | 9 | 3078.0 | opposite-strand | AhpC/TSA family |
| 2 | PF08534.12 | 0.6 | 9 | 3078.0 | opposite-strand | Redoxin |
| 3 | PF07992.16 | 0.6 | 9 | 1296.5 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 4 | PF00070.29 | 0.6 | 9 | 1296.5 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 5 | PF13192.8 | 0.6 | 9 | 1296.5 | opposite-strand | Thioredoxin domain |
| 6 | PF00582.28 | 1.0 | 15 | 1430 | same-strand | Universal stress protein family |
| 7 | PF01272.21 | 1.0 | 15 | 139.5 | same-strand | Transcription elongation factor, GreA/GreB, C-term |
| 8 | PF14760.8 | 1.0 | 15 | 139.5 | same-strand | Rnk N-terminus |
| 9 | PF00445.20 | 0.8 | 12 | 1406 | same-strand | Ribonuclease T2 family |
| 10 | PF01613.20 | 0.6 | 9 | 853 | opposite-strand | Flavin reductase like domain |
++ More..