Protein Information |
Information Type | Description |
---|---|
Protein name | Protein YkgV |
NCBI Accession ID | U00096.3 |
Organism | Escherichia coli (strain K12) |
Left | 294918 |
Right | 295142 |
Strand | - |
Nucleotide Sequence | ATGAGCGCATTCAAACTCCCGGATACATCTCAATCACAGCTCATTTCAACAGCTGAGTTAGCTAAAATCATTAGCTACAAATCTCAAACCATTCGTAAATGGCTTTGTCAGGACAAATTGCCTGAGGGGCTACCTCGCCCAAAACAAATCAATGGCCGCCATTACTGGTTACGTAAAGATGTCCTCGATTTTATAGATACATTTTCTGTACGAGAAAGTCTGTAA |
Sequence | MSAFKLPDTSQSQLISTAELAKIISYKSQTIRKWLCQDKLPEGLPRPKQINGRHYWLRKDVLDFIDTFSVRESL |
Source of smORF | Swiss-Prot |
Function | The ORF matches to the profile of cl02600. Profile Description: Helix-Turn-Helix DNA binding domain of transcription regulators from the MerR superfamily. This domain is a DNA-binding helix-turn-helix domain. |
Pubmed ID | 9278503 29645342 |
Domain | CDD:413393 |
Functional Category | Others |
Uniprot ID | P0DPM9 |
ORF Length (Amino Acid) | 74 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 294918 | 295142 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 1166120 | 1166341 | - | NZ_CP043318.1 | Enterobacter chengduensis |
3 | 3191136 | 3191357 | + | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF11726.10 | 1.0 | 3 | 1363 | same-strand | Inovirus Gp2 |
2 | PF00589.24 | 1.0 | 3 | 554 | same-strand | Phage integrase family |