Result : P0DPM7
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Protein YadW |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 176552 |
| Right | 176617 |
| Strand | + |
| Nucleotide Sequence | ATGGCGATTATTATTGGGTTAGAATTTGCCCAATTGCCGATGTCGTTTGGAGCAAAATATGAGTGA |
| Sequence | MAIIIGLEFAQLPMSFGAKYE |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 9278503 29645342 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P0DPM7 |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 8
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 180752 | 180817 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 176552 | 176617 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3731773 | 3731838 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 4 | 3437491 | 3437556 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 800700 | 800765 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 168207 | 168272 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 7 | 181269 | 181334 | + | NZ_AP014857.1 | Escherichia albertii |
| 8 | 1422821 | 1422886 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 9 | 2824194 | 2824259 | + | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00005.29 | 0.88 | 7 | 5892.0 | same-strand | ABC transporter |
| 2 | PF01497.20 | 1.0 | 8 | 2651.5 | both-strands | Periplasmic binding protein |
| 3 | PF01032.20 | 1.0 | 8 | 2985 | same-strand | FecCD transport family |
| 4 | PF00202.23 | 1.0 | 8 | 1670 | opposite-strand | Aminotransferase class-III |
| 5 | PF00654.22 | 1.0 | 8 | 24 | same-strand | Voltage gated chloride channel |
| 6 | PF01521.22 | 1.0 | 8 | -7 | same-strand | Iron-sulphur cluster biosynthesis |
| 7 | PF03458.15 | 1.0 | 8 | 384 | opposite-strand | Glycine transporter |
| 8 | PF01048.22 | 1.0 | 8 | 1838 | opposite-strand | Phosphorylase superfamily |
++ More..