Result : P0DPM5
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Protein YabR |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 85467 |
| Right | 85511 |
| Strand | - |
| Nucleotide Sequence | GTGAAAAGAAACGATAAAATCCTCCATTACAGAGGATTAAATTGA |
| Sequence | MKRNDKILHYRGLN |
| Source of smORF | Swiss-Prot |
| Function | |
| Pubmed ID | 9278503 29645342 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P0DPM5 |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 85467 | 85511 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 83308 | 83352 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00694.21 | 1.0 | 2 | 6013.5 | same-strand | Aconitase C-terminal domain |
| 2 | PF00330.22 | 1.0 | 2 | 4602.5 | same-strand | Aconitase family (aconitate hydratase) |
| 3 | PF00180.22 | 1.0 | 2 | 3508.5 | same-strand | Isocitrate/isopropylmalate dehydrogenase |
| 4 | PF00682.21 | 1.0 | 2 | 1937.5 | same-strand | HMGL-like |
| 5 | PF08502.12 | 1.0 | 2 | 1937.5 | same-strand | LeuA allosteric (dimerisation) domain |
| 6 | PF00126.29 | 1.0 | 2 | 155.0 | opposite-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 7 | PF03466.22 | 1.0 | 2 | 155.0 | opposite-strand | LysR substrate binding domain |
| 8 | PF02776.20 | 1.0 | 2 | 119.0 | opposite-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
| 9 | PF02775.23 | 1.0 | 2 | 119.0 | opposite-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
| 10 | PF00205.24 | 1.0 | 2 | 119.0 | opposite-strand | Thiamine pyrophosphate enzyme, central domain |
| 11 | PF10369.11 | 1.0 | 2 | 1846.0 | opposite-strand | Small subunit of acetolactate synthase |
| 12 | PF13710.8 | 1.0 | 2 | 1846.0 | opposite-strand | ACT domain |
| 13 | PF01842.27 | 1.0 | 2 | 1846.0 | opposite-strand | ACT domain |
| 14 | PF13291.8 | 1.0 | 2 | 1846.0 | opposite-strand | ACT domain |
| 15 | PF00356.23 | 1.0 | 2 | 2517.0 | opposite-strand | Bacterial regulatory proteins, lacI family |
| 16 | PF00532.23 | 1.0 | 2 | 2517.0 | opposite-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
| 17 | PF13377.8 | 1.0 | 2 | 2517.0 | opposite-strand | Periplasmic binding protein-like domain |
| 18 | PF13407.8 | 1.0 | 2 | 2517.0 | opposite-strand | Periplasmic binding protein domain |
| 19 | PF02381.20 | 1.0 | 2 | 4511.5 | opposite-strand | MraZ protein, putative antitoxin-like |
++ More..