| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | iraD leader peptide |
| NCBI Accession ID | U00096.3 |
| Organism | Escherichia coli (strain K12) |
| Left | 4556913 |
| Right | 4556996 |
| Strand | + |
| Nucleotide Sequence | ATGGAAAATGAGCATCAATACAGTGGTGCCCGGTGTTCAGGGCAAGCCGCATATGTTGCTAAACGTCAGGAGTGCGCAAAATGA |
| Sequence | MENEHQYSGARCSGQAAYVAKRQECAK |
| Source of smORF | Swiss-Prot |
| Function | A short protein whose stop codon overlaps with the start codon of downstream iraD; its mRNA secondary structure is predicted to fold and sequester the Shine-Dalgarno sequence of iraD. When this protein is expressed the downstream iraD is also expressed due to ribosomal coupling (Pubmed:28851853). {ECO:0000269|Pubmed:28851853}. |
| Pubmed ID | 9278503 28851853 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P0DPC6 |
| ORF Length (Amino Acid) | 27 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5411862 | 5411945 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 4556913 | 4556996 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 4366661 | 4366744 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 4584470 | 4584553 | + | NZ_AP014857.1 | Escherichia albertii |
| 5 | 551897 | 551980 | + | NZ_LR134340.1 | Escherichia marmotae |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF08125.15 | 1.0 | 4 | 2552 | same-strand | Mannitol dehydrogenase C-terminal domain |
| 2 | PF01232.25 | 1.0 | 4 | 2552 | same-strand | Mannitol dehydrogenase Rossmann domain |
| 3 | PF07729.14 | 1.0 | 4 | 1564 | same-strand | FCD domain |
| 4 | PF00392.23 | 1.0 | 4 | 1564 | same-strand | Bacterial regulatory proteins, gntR family |
| 5 | PF10887.10 | 0.75 | 3 | 593.0 | opposite-strand | Protein of unknown function (DUF2686) |
| 6 | PF04965.16 | 1.0 | 4 | -3 | same-strand | Baseplate wedge protein gp25 |
| 7 | PF03786.15 | 0.75 | 3 | 4071 | same-strand | D-mannonate dehydratase (UxuA) |