Result : A4WNY7
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | ATP synthase subunit c (ATP synthase F(0) sector subunit c) (F-type ATPase subunit c) (F-ATPase subunit c) (Lipid-binding protein) |
| NCBI Accession ID | CP000661.1 |
| Organism | Rhodobacter sphaeroides (strain ATCC 17025 / ATH 2.4.3) |
| Left | 182408 |
| Right | 182644 |
| Strand | + |
| Nucleotide Sequence | ATGGAAGGCGATATCGCAGAAATGGGCAAATTCATCGGCGCGGGCCTGGCCACCATCGGCCTCGGCGGTGCTGGTATCGGCGTGGGCCACGTCGCTGGCAACTTCCTCGCCGGCGCCCTCCGCAACCCGTCGGCCGCTCCGGGCCAGATGGCGAACCTCTTCGTTGGCATCGCCTTCGCGGAAGCCCTCGGCATCTTCTCGTTCCTGATCGCGCTCCTGCTGATGTTCGCCGTCTGA |
| Sequence | MEGDIAEMGKFIGAGLATIGLGGAGIGVGHVAGNFLAGALRNPSAAPGQMANLFVGIAFAEALGIFSFLIALLLMFAV |
| Source of smORF | Swiss-Prot |
| Function | F(1)F(0) ATP synthase produces ATP from ADP in the presence of a proton or sodium gradient. F-type ATPases consist of two structural domains, F(1) containing the extramembraneous catalytic core and F(0) containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. {ECO:0000255|HAMAP-Rule:MF_01396}.; Key component of the F(0) channel; it plays a direct role in translocation across the membrane. A homomeric c-ring of between 10-14 subunits forms the central stalk rotor element with the F(1) delta and epsilon subunits. {ECO:0000255|HAMAP-Rule:MF_01396}. |
| Pubmed ID | |
| Domain | CDD:412393 |
| Functional Category | Others |
| Uniprot ID | A4WNY7 |
| ORF Length (Amino Acid) | 78 |
++ More..
| Conservation Analysis |
No. of Species: 100
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2651245 | 2651481 | + | NZ_CP034328.1 | Tabrizicola piscis |
| 2 | 2342098 | 2342334 | - | NZ_CP061498.1 | Roseicitreum antarcticum |
| 3 | 675793 | 676029 | + | NZ_CP054599.1 | Sulfitobacter pseudonitzschiae |
| 4 | 3221296 | 3221532 | - | NZ_CP032125.1 | Profundibacter amoris |
| 5 | 1666795 | 1667031 | + | NZ_CP024899.1 | Rhodobaca barguzinensis |
| 6 | 3660041 | 3660277 | - | NZ_CP053562.1 | Thioclava electrotropha |
| 7 | 3650911 | 3651147 | - | NZ_CP019437.1 | Thioclava nitratireducens |
| 8 | 1403431 | 1403667 | - | NZ_CP025430.1 | Paracoccus zhejiangensis |
| 9 | 1789563 | 1789799 | - | NZ_CP042261.1 | Qingshengfaniella alkalisoli |
| 10 | 749422 | 749658 | + | NZ_CP004393.1 | Celeribacter indicus |
| 11 | 132320 | 132556 | - | NZ_CP015421.1 | Rhodovulum sulfidophilum |
| 12 | 1181945 | 1182181 | - | NZ_CP012023.1 | Celeribacter marinus |
| 13 | 100189 | 100425 | + | NZ_CP003984.1 | Planktomarina temperata RCA23 |
| 14 | 2831857 | 2832093 | + | NZ_CP020470.1 | Rhodobacter blasticus |
| 15 | 1689996 | 1690232 | - | NZ_CP038439.1 | Paracoccus liaowanqingii |
| 16 | 1441658 | 1441894 | - | NZ_CP035510.1 | Haematobacter massiliensis |
| 17 | 144538 | 144774 | + | NZ_CP039965.1 | Pseudorhodobacter turbinis |
| 18 | 2733103 | 2733339 | - | NZ_CP045201.1 | Pseudopuniceibacterium antarcticum |
| 19 | 545976 | 546212 | + | NZ_CP021404.1 | Pacificitalea manganoxidans |
| 20 | 189649 | 189885 | + | NZ_CP033219.1 | Parasedimentitalea marina |
| 21 | 2640446 | 2640670 | - | NZ_CP015230.1 | Epibacterium mobile F1926 |
| 22 | 2457332 | 2457568 | - | NZ_CP060436.1 | Pseudooceanicola algae |
| 23 | 110401 | 110637 | + | NC_023135.1 | Leisingera methylohalidivorans DSM 14336 |
| 24 | 416953 | 417189 | + | NZ_CP034588.1 | Silicimonas algicola |
| 25 | 1626087 | 1626323 | + | NZ_CP004372.1 | Roseibacterium elongatum DSM 19469 |
| 26 | 3012128 | 3012364 | + | NZ_CP049037.1 | Pseudohalocynthiibacter aestuariivivens |
| 27 | 3105942 | 3106178 | - | NZ_CP034348.1 | Roseovarius faecimaris |
| 28 | 3016507 | 3016743 | - | NZ_CP041159.1 | Leisingera aquaemixtae |
| 29 | 833338 | 833574 | + | NZ_CP061202.1 | Rhodobacter capsulatus |
| 30 | 3274912 | 3275148 | + | NZ_CP022196.1 | Celeribacter ethanolicus |
| 31 | 311941 | 312165 | + | NZ_CP016364.1 | Phaeobacter porticola |
| 32 | 3231493 | 3231717 | - | NZ_CP010650.1 | Phaeobacter inhibens |
| 33 | 214732 | 214956 | + | NZ_CP021047.1 | Phaeobacter gallaeciensis |
| 34 | 4856544 | 4856771 | + | NC_009937.1 | Azorhizobium caulinodans ORS 571 |
| 35 | 107759 | 107989 | + | NZ_CP019937.1 | Ketogulonicigenium robustum |
| 36 | 205041 | 205271 | + | NZ_CP012908.1 | Ketogulonicigenium vulgare |
| 37 | 1936078 | 1936317 | + | NZ_CP030918.1 | Paracoccus suum |
| 38 | 772443 | 772682 | - | NZ_CP014327.1 | Halocynthiibacter arcticus |
| 39 | 2241705 | 2241944 | - | NZ_CP040818.1 | Paraoceanicella profunda |
| 40 | 756561 | 756785 | - | NC_009719.1 | Parvibaculum lavamentivorans DS-1 |
| 41 | 510299 | 510532 | + | NZ_CP012661.1 | Defluviimonas alba |
| 42 | 446008 | 446244 | + | NZ_CP065915.1 | Pelagovum pacificum |
| 43 | 597479 | 597694 | + | NZ_CP025583.1 | Paracoccus jeotgali |
| 44 | 2623798 | 2624022 | + | NZ_CP022048.2 | Brevundimonas vesicularis |
| 45 | 2035971 | 2036213 | + | NZ_CP020612.1 | Paracoccus contaminans |
| 46 | 512913 | 513137 | - | NZ_CP029479.1 | Phenylobacterium parvum |
| 47 | 1045190 | 1045417 | - | NZ_AP014648.1 | Methyloceanibacter caenitepidi |
| 48 | 433627 | 433854 | - | NZ_AP014946.1 | Variibacter gotjawalensis |
| 49 | 3440203 | 3440427 | - | NC_003911.12 | Ruegeria pomeroyi DSS-3 |
| 50 | 1422386 | 1422619 | + | NZ_CP045073.1 | Paracoccus kondratievae |
| 51 | 2378360 | 2378587 | - | NZ_CP017147.1 | Bosea vaviloviae |
| 52 | 430110 | 430340 | + | NZ_CP024201.1 | Caulobacter mirabilis |
| 53 | 2554844 | 2555068 | - | NZ_LR588407.1 | Brevundimonas vancanneytii |
| 54 | 2979927 | 2980130 | + | NC_014313.1 | Hyphomicrobium denitrificans ATCC 51888 |
| 55 | 1293831 | 1294055 | - | NZ_CP045423.1 | Microvirga thermotolerans |
| 56 | 1285218 | 1285442 | + | NZ_CP016616.1 | Microvirga ossetica |
| 57 | 3036980 | 3037183 | - | NZ_CP061205.1 | Kordiimonas pumila |
| 58 | 1167287 | 1167511 | - | NC_014816.1 | Asticcacaulis excentricus CB 48 |
| 59 | 2718210 | 2718434 | + | NC_014375.1 | Brevundimonas subvibrioides ATCC 15264 |
| 60 | 620902 | 621126 | + | NC_011144.1 | Phenylobacterium zucineum HLK1 |
| 61 | 2670055 | 2670267 | - | NZ_CP042306.1 | Sphingomonas panacisoli |
| 62 | 1128110 | 1128334 | - | NC_012982.1 | Hirschia baltica ATCC 49814 |
| 63 | 1232347 | 1232568 | + | NZ_LT960614.1 | Hartmannibacter diazotrophicus |
| 64 | 3205097 | 3205309 | - | NZ_CP061038.1 | Sphingomonas alpina |
| 65 | 323296 | 323520 | - | NZ_CP013002.1 | Caulobacter henricii |
| 66 | 1931990 | 1932214 | + | NZ_CP026100.1 | Caulobacter flavus |
| 67 | 4996652 | 4996879 | + | NZ_CP048815.1 | Caulobacter rhizosphaerae |
| 68 | 831399 | 831629 | - | NC_010581.1 | Beijerinckia indica subsp. indica ATCC 9039 |
| 69 | 1191219 | 1191443 | - | NZ_CP009291.1 | Novosphingobium pentaromativorans US6-1 |
| 70 | 4708112 | 4708327 | - | NZ_CP014168.1 | Sphingomonas panacis |
| 71 | 196794 | 197000 | + | NZ_CP051131.1 | Parasphingopyxis algicola |
| 72 | 1268549 | 1268776 | + | NZ_CP071057.1 | Marinicauda algicola |
| 73 | 388756 | 388980 | - | NC_011916.1 | Caulobacter vibrioides NA1000 |
| 74 | 354726 | 354950 | - | NZ_CP027850.1 | Caulobacter segnis |
| 75 | 2537824 | 2538048 | + | NZ_CP047045.1 | Terricaulis silvestris |
| 76 | 1173556 | 1173780 | - | NC_022997.1 | Hyphomicrobium nitrativorans NL23 |
| 77 | 1753304 | 1753513 | - | NZ_CP023705.1 | Sphingomonas melonis |
| 78 | 2242445 | 2242651 | - | NZ_CP009571.1 | Sphingomonas taxi |
| 79 | 3558946 | 3559173 | + | NZ_CP035765.1 | Sphingomonas paucimobilis |
| 80 | 5826242 | 5826466 | - | NZ_CP033507.1 | Mesorhizobium jarvisii |
| 81 | 5803151 | 5803375 | - | NC_015675.1 | Mesorhizobium opportunistum WSM2075 |
| 82 | 5227675 | 5227899 | - | NC_019973.1 | Mesorhizobium australicum WSM2073 |
| 83 | 1385719 | 1385949 | - | NZ_CP010401.1 | Bartonella ancashensis |
| 84 | 3778660 | 3778887 | - | NZ_CP023449.1 | Rhizorhabdus dicambivorans |
| 85 | 4930396 | 4930623 | + | NC_009511.1 | Sphingomonas wittichii RW1 |
| 86 | 1088155 | 1088376 | + | NZ_CP031843.2 | Bartonella kosoyi |
| 87 | 656707 | 656928 | + | NC_010161.1 | Bartonella tribocorum CIP 105476 |
| 88 | 1691345 | 1691572 | + | NC_014664.1 | Rhodomicrobium vannielii ATCC 17100 |
| 89 | 501886 | 502113 | - | NZ_CP041659.1 | Sphingomonas xanthus |
| 90 | 1766055 | 1766279 | + | NZ_CP015064.1 | Mesorhizobium ciceri biovar biserrulae |
| 91 | 1388510 | 1388737 | - | NZ_CP060717.1 | Sphingomonas rhizophila |
| 92 | 2508200 | 2508424 | + | NZ_CP015318.1 | Mesorhizobium amorphae CCNWGS0123 |
| 93 | 73060 | 73287 | + | NZ_CP018221.1 | Tardibacter chloracetimidivorans |
| 94 | 979258 | 979485 | - | NZ_CP045434.1 | Sphingomonas ginsengisoli An et al. 2013 |
| 95 | 839857 | 840084 | - | NC_020453.1 | Bradyrhizobium oligotrophicum S58 |
| 96 | 893595 | 893798 | - | NZ_CP042582.1 | Hypericibacter adhaerens |
| 97 | 1660084 | 1660290 | + | NZ_CP060782.1 | Sphingomonas sediminicola |
| 98 | 1385530 | 1385757 | - | NZ_CP012669.1 | Altererythrobacter epoxidivorans |
| 99 | 1485948 | 1486175 | + | NZ_CP015963.1 | Altererythrobacter ishigakiensis |
| 100 | 574942 | 575169 | + | NZ_CP037948.1 | Qipengyuania sediminis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP034328.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF09527.12 | 0.95 | 95 | 850 | same-strand | Putative F0F1-ATPase subunit Ca2+/Mg2+ transporter |
| 2 | PF00119.22 | 1.0 | 100 | 58.0 | same-strand | ATP synthase A chain |
| 3 | PF00430.20 | 1.0 | 100 | 503 | same-strand | ATP synthase B/B' CF(0) |
| 4 | PF02326.17 | 0.77 | 77 | 87 | same-strand | Plant ATP synthase F0 |
++ More..