Result : P0CW29
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Putative antitoxin VapB1 |
| NCBI Accession ID | AL123456.3 |
| Organism | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) |
| Left | 71589 |
| Right | 71828 |
| Strand | + |
| Nucleotide Sequence | ATGGCTACCATTCAAGTTCGGGATTTGCCCGAAGATGTCGCCGAAACCTATCGACGGCGCGCCACCGCAGCGGGGCAGTCGCTGCAGACGTATATGCGCACCAAGCTCATCGAAGGGGTGCGGGGCCGAGACAAGGCCGAGGCAATCGAGATCCTGGAACAGGCGCTCGCCAGCACTGCCAGCCCAGGCATCAGCCGGGAGACCATCGAGGCATCCCGGCGGGAGCTCAGGGGTGGATGA |
| Sequence | MATIQVRDLPEDVAETYRRRATAAGQSLQTYMRTKLIEGVRGRDKAEAIEILEQALASTASPGISRETIEASRRELRGG |
| Source of smORF | Swiss-Prot |
| Function | Antitoxin component of a possible type II toxin-antitoxin (TA) system. The cognate toxin is VapC1. {ECO:0000305|Pubmed:15718296}. |
| Pubmed ID | 9634230 15718296 |
| Domain | |
| Functional Category | Antitoxin_type_2 |
| Uniprot ID | P0CW29 |
| ORF Length (Amino Acid) | 79 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 71589 | 71828 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 73650 | 73889 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 3 | 2297998 | 2298237 | - | NZ_AP022583.1 | Mycobacterium noviomagense |
| 4 | 1852338 | 1852577 | - | NZ_LR134352.1 | Nocardia asteroides |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01850.23 | 1.0 | 4 | -7.0 | same-strand | PIN domain |
++ More..