Result : P0AFU6

Protein Information

• Protein name: Uncharacterized protein YiiF
• NCBI Accession ID: U00096.3
• Organism: Escherichia coli (strain K12)
• Left: 4079751
• Right: 4079969
• Strand: +
• Nucleotide Sequence: ATGGGCAGAATTTTACTCGATTTATCGAATGAGGTGATTAAGCAACTTGATGATCTCGAGGTGCAGCGTAATCTTCCTCGTGCGGACCTATTAAGGGAAGCGGTAGATCAATACCTGATAAATCAATCGCAAACAGCAAGAACCAGTGTTCCTGGCATCTGGCAAGGGTGTGAGGAAGATGGTGTCGAATATCAGCGTAAGCTGCGCGAGGAATGGTAA
• Sequence: MGRILLDLSNEVIKQLDDLEVQRNLPRADLLREAVDQYLINQSQTARTSVPGIWQGCEEDGVEYQRKLREEW
• Source of smORF: Swiss-Prot
• Pubmed ID: 8346018 9278503 16738553
• Functional Category: Others
• Uniprot ID: P0AFU6
• ORF Length (Amino Acid): 72

Conservation Analysis

No. of Species: 22

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	4095160	4095378	+	NC_004337.2	Shigella flexneri 2a str. 301
2	4079751	4079969	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	4878514	4878732	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
4	3255715	3255933	-	NZ_CP038469.1	Citrobacter tructae
5	2848452	2848676	+	NZ_CP033744.1	Citrobacter freundii
6	2890738	2890962	-	NC_009792.1	Citrobacter koseri ATCC BAA-895
7	1026687	1026911	-	NZ_LT556085.1	Citrobacter amalonaticus
8	647572	647796	+	NZ_CP045205.1	Citrobacter telavivensis
9	3402900	3403124	-	NZ_CP023529.1	Lelliottia amnigena
10	6089011	6089238	-	NZ_CP036175.1	Klebsiella huaxiensis
11	42970	43194	+	NC_016845.1	Klebsiella pneumoniae subsp. pneumoniae HS11286
12	4076122	4076346	-	NC_013716.1	Citrobacter rodentium ICC168
13	5454899	5455123	-	NZ_CP054254.1	Klebsiella variicola
14	279681	279899	-	NZ_AP023184.1	Buttiauxella agrestis
15	965	1183	+	NZ_CP012871.1	[Enterobacter] lignolyticus
16	2665252	2665470	+	NZ_CP025034.2	Enterobacter sp. SGAir0187
17	4712976	4713194	-	NC_015968.1	Enterobacter soli
18	4639760	4639978	-	NZ_CP027986.1	Enterobacter sichuanensis
19	2533463	2533681	+	NZ_AP019007.1	Enterobacter oligotrophicus
20	4767801	4768019	-	NZ_CP009756.1	Enterobacter cloacae
21	4542443	4542661	-	NZ_AP022508.1	Enterobacter bugandensis
22	812062	812280	-	NZ_CP020388.1	Pluralibacter gergoviae
23	3013618	3013833	+	NZ_CP057657.1	Escherichia fergusonii

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NZ_CP038469.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF04216.14	1.0	22	414	opposite-strand	Protein involved in formate dehydrogenase formation
2	PF01292.22	0.82	18	1340	opposite-strand	Prokaryotic cytochrome b561
3	PF13247.8	0.82	18	1972	opposite-strand	4Fe-4S dicluster domain
4	PF09163.13	0.82	18	1972	opposite-strand	Formate dehydrogenase N, transmembrane
5	PF12838.9	0.82	18	1972	opposite-strand	4Fe-4S dicluster domain
6	PF13187.8	0.82	18	1972	opposite-strand	4Fe-4S dicluster domain
7	PF13237.8	0.82	18	1972	opposite-strand	4Fe-4S dicluster domain
8	PF12837.9	0.82	18	1972	opposite-strand	4Fe-4S binding domain
9	PF14697.8	0.82	18	1972	opposite-strand	4Fe-4S dicluster domain
10	PF01568.23	0.82	18	2887	opposite-strand	Molydopterin dinucleotide binding domain
11	PF03631.17	0.82	18	2574.0	same-strand	Virulence factor BrkB
12	PF02580.18	0.86	19	2141.0	same-strand	D-Tyr-tRNA(Tyr) deacylase
13	PF09500.12	0.91	20	1154	same-strand	Putative thioesterase (yiiD Cterm)
14	PF00583.27	0.86	19	1155.0	same-strand	Acetyltransferase (GNAT) family
15	PF13508.9	0.91	20	1154	same-strand	Acetyltransferase (GNAT) domain
16	PF01850.23	0.86	19	0	same-strand	PIN domain
17	PF07859.15	0.64	14	224.0	opposite-strand	alpha/beta hydrolase fold