Protein Information |
Information Type | Description |
---|---|
Protein name | Uncharacterized protein YiiF |
NCBI Accession ID | U00096.3 |
Organism | Escherichia coli (strain K12) |
Left | 4079751 |
Right | 4079969 |
Strand | + |
Nucleotide Sequence | ATGGGCAGAATTTTACTCGATTTATCGAATGAGGTGATTAAGCAACTTGATGATCTCGAGGTGCAGCGTAATCTTCCTCGTGCGGACCTATTAAGGGAAGCGGTAGATCAATACCTGATAAATCAATCGCAAACAGCAAGAACCAGTGTTCCTGGCATCTGGCAAGGGTGTGAGGAAGATGGTGTCGAATATCAGCGTAAGCTGCGCGAGGAATGGTAA |
Sequence | MGRILLDLSNEVIKQLDDLEVQRNLPRADLLREAVDQYLINQSQTARTSVPGIWQGCEEDGVEYQRKLREEW |
Source of smORF | Swiss-Prot |
Function | |
Pubmed ID | 8346018 9278503 16738553 |
Domain | |
Functional Category | Others |
Uniprot ID | P0AFU6 |
ORF Length (Amino Acid) | 72 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4095160 | 4095378 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
2 | 4079751 | 4079969 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 4878514 | 4878732 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
4 | 3255715 | 3255933 | - | NZ_CP038469.1 | Citrobacter tructae |
5 | 2848452 | 2848676 | + | NZ_CP033744.1 | Citrobacter freundii |
6 | 2890738 | 2890962 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
7 | 1026687 | 1026911 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
8 | 647572 | 647796 | + | NZ_CP045205.1 | Citrobacter telavivensis |
9 | 3402900 | 3403124 | - | NZ_CP023529.1 | Lelliottia amnigena |
10 | 6089011 | 6089238 | - | NZ_CP036175.1 | Klebsiella huaxiensis |
11 | 42970 | 43194 | + | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
12 | 4076122 | 4076346 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
13 | 5454899 | 5455123 | - | NZ_CP054254.1 | Klebsiella variicola |
14 | 279681 | 279899 | - | NZ_AP023184.1 | Buttiauxella agrestis |
15 | 965 | 1183 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
16 | 2665252 | 2665470 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
17 | 4712976 | 4713194 | - | NC_015968.1 | Enterobacter soli |
18 | 4639760 | 4639978 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
19 | 2533463 | 2533681 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
20 | 4767801 | 4768019 | - | NZ_CP009756.1 | Enterobacter cloacae |
21 | 4542443 | 4542661 | - | NZ_AP022508.1 | Enterobacter bugandensis |
22 | 812062 | 812280 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
23 | 3013618 | 3013833 | + | NZ_CP057657.1 | Escherichia fergusonii |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF04216.14 | 1.0 | 22 | 414 | opposite-strand | Protein involved in formate dehydrogenase formation |
2 | PF01292.22 | 0.82 | 18 | 1340 | opposite-strand | Prokaryotic cytochrome b561 |
3 | PF13247.8 | 0.82 | 18 | 1972 | opposite-strand | 4Fe-4S dicluster domain |
4 | PF09163.13 | 0.82 | 18 | 1972 | opposite-strand | Formate dehydrogenase N, transmembrane |
5 | PF12838.9 | 0.82 | 18 | 1972 | opposite-strand | 4Fe-4S dicluster domain |
6 | PF13187.8 | 0.82 | 18 | 1972 | opposite-strand | 4Fe-4S dicluster domain |
7 | PF13237.8 | 0.82 | 18 | 1972 | opposite-strand | 4Fe-4S dicluster domain |
8 | PF12837.9 | 0.82 | 18 | 1972 | opposite-strand | 4Fe-4S binding domain |
9 | PF14697.8 | 0.82 | 18 | 1972 | opposite-strand | 4Fe-4S dicluster domain |
10 | PF01568.23 | 0.82 | 18 | 2887 | opposite-strand | Molydopterin dinucleotide binding domain |
11 | PF03631.17 | 0.82 | 18 | 2574.0 | same-strand | Virulence factor BrkB |
12 | PF02580.18 | 0.86 | 19 | 2141.0 | same-strand | D-Tyr-tRNA(Tyr) deacylase |
13 | PF09500.12 | 0.91 | 20 | 1154 | same-strand | Putative thioesterase (yiiD Cterm) |
14 | PF00583.27 | 0.86 | 19 | 1155.0 | same-strand | Acetyltransferase (GNAT) family |
15 | PF13508.9 | 0.91 | 20 | 1154 | same-strand | Acetyltransferase (GNAT) domain |
16 | PF01850.23 | 0.86 | 19 | 0 | same-strand | PIN domain |
17 | PF07859.15 | 0.64 | 14 | 224.0 | opposite-strand | alpha/beta hydrolase fold |