Result : P0AF88
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Uncharacterized protein YjfY |
| NCBI Accession ID | AE005174.2 |
| Organism | Escherichia coli O157:H7 |
| Left | 5308228 |
| Right | 5308503 |
| Strand | - |
| Nucleotide Sequence | ATGTTCAGTCGAGTTTTAGCCCTTCTGGCTGTGCTTTTGCTAAGTGCAAATACATGGGCAGCCATTGAAATTAATAACCACCAGGCCAGAAATATGGACGATGTGCAAAGCTTAGGCGTGATTTATATCAATCATAATTTCGCCACTGAAAGCGAAGCACGTCAGGCATTAAATGAAGAAACAGATGCGCAAGGCGCAACGTACTACCACGTAATTCTGATGCGGGAACCGGGGAGTAACGGCAATATGCACGCCAGCGCGGATATTTATCGCTAG |
| Sequence | MFSRVLALLAVLLLSANTWAAIEINNHQARNMDDVQSLGVIYINHNFATESEARQALNEETDAQGATYYHVILMREPGSNGNMHASADIYR |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl11507. Profile Description: Protein of unknown function (DUF1471). hypothetical protein; Provisional |
| Pubmed ID | 11206551 11258796 |
| Domain | CDD:416304 |
| Functional Category | Others |
| Uniprot ID | P0AF88 |
| ORF Length (Amino Acid) | 91 |
++ More..
| Conservation Analysis |
No. of Species: 40
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4528793 | 4529068 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 2 | 4424516 | 4424791 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 5278369 | 5278644 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 450616 | 450891 | - | NZ_LR134340.1 | Escherichia marmotae |
| 5 | 3345174 | 3345449 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 4459654 | 4459929 | - | NZ_AP014857.1 | Escherichia albertii |
| 7 | 582616 | 582891 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 8 | 1082841 | 1083116 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 9 | 445870 | 446091 | - | NC_015968.1 | Enterobacter soli |
| 10 | 3077474 | 3077749 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 11 | 3536201 | 3536422 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 12 | 453133 | 453354 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 13 | 2983156 | 2983377 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 14 | 1865275 | 1865550 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 15 | 3215693 | 3215968 | - | NZ_CP033744.1 | Citrobacter freundii |
| 16 | 440316 | 440537 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 17 | 2408726 | 2409001 | - | NZ_CP053416.1 | Salmonella bongori |
| 18 | 3912993 | 3913268 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 19 | 2891678 | 2891953 | + | NZ_CP038469.1 | Citrobacter tructae |
| 20 | 451452 | 451673 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 21 | 463888 | 464109 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 22 | 557234 | 557455 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 23 | 3383427 | 3383702 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 24 | 4629783 | 4630058 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 25 | 4013990 | 4014229 | + | NZ_AP023184.1 | Buttiauxella agrestis |
| 26 | 4103361 | 4103582 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 27 | 4378823 | 4379098 | + | NZ_CP023525.1 | Cedecea neteri |
| 28 | 463259 | 463480 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 29 | 4190509 | 4190784 | + | NZ_CP045845.1 | Kluyvera intermedia |
| 30 | 5514369 | 5514608 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 31 | 476205 | 476456 | - | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 32 | 5026894 | 5027145 | + | NZ_CP054254.1 | Klebsiella variicola |
| 33 | 4745762 | 4746013 | + | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 34 | 4871202 | 4871441 | + | NZ_CP014007.2 | Kosakonia oryzae |
| 35 | 209270 | 209509 | - | NZ_CP015113.1 | Kosakonia radicincitans |
| 36 | 1460609 | 1460875 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 37 | 2651404 | 2651643 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 38 | 3433528 | 3433803 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 39 | 3684355 | 3684609 | + | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
| 40 | 3635124 | 3635366 | - | NZ_CP016337.1 | Kosakonia sacchari |
| 41 | 4713947 | 4714222 | + | NZ_LR134475.1 | Klebsiella aerogenes |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_004337.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02302.19 | 0.65 | 26 | 2824 | opposite-strand | PTS system, Lactose/Cellobiose specific IIB subunit |
| 2 | PF00359.24 | 0.78 | 31 | 2350.0 | opposite-strand | Phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 2 |
| 3 | PF00215.26 | 0.78 | 31 | 1686.5 | opposite-strand | Orotidine 5'-phosphate decarboxylase / HUMPS family |
| 4 | PF01261.26 | 0.78 | 31 | 819.0 | opposite-strand | Xylose isomerase-like TIM barrel |
| 5 | PF00596.23 | 0.78 | 31 | 137.0 | opposite-strand | Class II Aldolase and Adducin N-terminal domain |
| 6 | PF01250.19 | 1.0 | 40 | 380 | opposite-strand | Ribosomal protein S6 |
| 7 | PF00436.27 | 1.0 | 40 | 782 | opposite-strand | Single-strand binding protein family |
| 8 | PF01084.22 | 1.0 | 40 | 1101 | opposite-strand | Ribosomal protein S18 |
| 9 | PF03948.16 | 1.0 | 40 | 1370 | opposite-strand | Ribosomal protein L9, C-terminal domain |
| 10 | PF01281.21 | 1.0 | 40 | 1370 | opposite-strand | Ribosomal protein L9, N-terminal domain |
++ More..