Result : P0AD93
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | trp operon leader peptide |
| NCBI Accession ID | AE014075.1 |
| Organism | Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC) |
| Left | 1566642 |
| Right | 1566686 |
| Strand | - |
| Nucleotide Sequence | ATGAAAGCAATTTTCGTACTGAAAGGTTGGTGGCGCACTTCCTGA |
| Sequence | MKAIFVLKGWWRTS |
| Source of smORF | Swiss-Prot |
| Function | This protein is involved in control of the biosynthesis of tryptophan. {ECO:0000250}. |
| Pubmed ID | 12471157 |
| Domain | |
| Functional Category | Others |
| Uniprot ID | P0AD93 |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 13
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1824195 | 1824239 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1373149 | 1373193 | - | NZ_AP014857.1 | Escherichia albertii |
| 3 | 1323038 | 1323082 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 1319359 | 1319403 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 725429 | 725473 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 2416931 | 2416975 | + | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 2370032 | 2370076 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 8 | 1847886 | 1847930 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 9 | 4681537 | 4681581 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 10 | 1310034 | 1310078 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 11 | 1155756 | 1155800 | + | NZ_CP038469.1 | Citrobacter tructae |
| 12 | 388364 | 388408 | + | NZ_CP033744.1 | Citrobacter freundii |
| 13 | 4329696 | 4329740 | + | NZ_CP053416.1 | Salmonella bongori |
| 14 | 1818405 | 1818449 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00290.22 | 1.0 | 13 | 5816.5 | same-strand | Tryptophan synthase alpha chain |
| 2 | PF00291.27 | 1.0 | 13 | 4623.5 | same-strand | Pyridoxal-phosphate dependent enzyme |
| 3 | PF00218.23 | 1.0 | 13 | 3254.0 | same-strand | Indole-3-glycerol phosphate synthase |
| 4 | PF00697.24 | 1.0 | 13 | 3254.0 | same-strand | N-(5'phosphoribosyl)anthranilate (PRA) isomerase |
| 5 | PF00591.23 | 1.0 | 13 | 1655.0 | same-strand | Glycosyl transferase family, a/b domain |
| 6 | PF00117.30 | 1.0 | 13 | 1655.0 | same-strand | Glutamine amidotransferase class-I |
| 7 | PF02885.19 | 1.0 | 13 | 1655.0 | same-strand | Glycosyl transferase family, helical bundle domain |
| 8 | PF00425.20 | 1.0 | 13 | 93.0 | same-strand | chorismate binding enzyme |
| 9 | PF04715.15 | 1.0 | 13 | 93.0 | same-strand | Anthranilate synthase component I, N terminal region |
| 10 | PF02811.21 | 0.62 | 8 | 138 | opposite-strand | PHP domain |
| 11 | PF01300.20 | 1.0 | 13 | 1015.5 | opposite-strand | Telomere recombination |
| 12 | PF00849.24 | 0.92 | 12 | 1737 | opposite-strand | RNA pseudouridylate synthase |
| 13 | PF01479.27 | 1.0 | 13 | 1737.0 | opposite-strand | S4 domain |
| 14 | PF02572.17 | 0.77 | 10 | 2694 | same-strand | ATP:corrinoid adenosyltransferase BtuR/CobO/CobP |
++ More..